Incidental Mutation 'R5979:Muc2'
ID 481313
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 044161-MU
Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 141690340-141754693 bp(+) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to G at 141697250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000167366
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179227
SMART Domains Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
C8 11 85 1.61e-32 SMART
Blast:VWD 102 128 5e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000185406
AA Change: T702A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: T702A

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.5e-40 SMART
C8 216 290 3.9e-15 SMART
Pfam:TIL 293 349 5.4e-10 PFAM
VWC 351 411 7e-4 SMART
VWD 378 542 8.8e-44 SMART
C8 579 653 1.2e-36 SMART
SCOP:d1coua_ 654 728 4e-8 SMART
VWC_def 820 865 1.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185823
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187789
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense probably benign 0.35
kenny APN 7 nonsense
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense probably benign
IGL01482:Muc2 APN 7 141754060 missense probably damaging 0.96
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense probably damaging 1.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense probably damaging 1.00
IGL02836:Muc2 APN 7 141746713 unclassified probably benign
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
Seco UTSW 7 141698733 missense probably damaging 1.00
BB001:Muc2 UTSW 7 141695388 missense probably damaging 1.00
BB011:Muc2 UTSW 7 141695388 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2149:Muc2 UTSW 7 141699185 frame shift probably null
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 unclassified probably benign
R3112:Muc2 UTSW 7 141745488 unclassified probably benign
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 unclassified probably benign
R3974:Muc2 UTSW 7 141746804 unclassified probably benign
R3976:Muc2 UTSW 7 141746804 unclassified probably benign
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.32
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 unclassified probably benign
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6321:Muc2 UTSW 7 141700828 missense probably benign 0.28
R6390:Muc2 UTSW 7 141752146 missense probably damaging 0.97
R6485:Muc2 UTSW 7 141746736 unclassified probably benign
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
R6683:Muc2 UTSW 7 141751477 missense probably benign 0.38
R6896:Muc2 UTSW 7 141752695 missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141698733 missense probably damaging 1.00
R6924:Muc2 UTSW 7 141697834 missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141751457 missense unknown
R7222:Muc2 UTSW 7 141704209 missense
R7251:Muc2 UTSW 7 141692722 missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141752744 missense
R7315:Muc2 UTSW 7 141690402 missense probably damaging 0.99
R7421:Muc2 UTSW 7 141748126 missense
R7556:Muc2 UTSW 7 141753702 missense
R7651:Muc2 UTSW 7 141704201 missense
R7710:Muc2 UTSW 7 141700883 missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141704393 missense
R7813:Muc2 UTSW 7 141696300 splice site probably null
R7843:Muc2 UTSW 7 141695419 missense probably benign 0.03
R7869:Muc2 UTSW 7 141749734 missense
R7924:Muc2 UTSW 7 141695388 missense probably damaging 1.00
R7993:Muc2 UTSW 7 141754436 missense
R8053:Muc2 UTSW 7 141698332 missense probably benign 0.01
R8068:Muc2 UTSW 7 141744685 missense
R8099:Muc2 UTSW 7 141745438 splice site probably null
R8192:Muc2 UTSW 7 141751478 missense
R8194:Muc2 UTSW 7 141704252 missense
R8545:Muc2 UTSW 7 141752393 missense unknown
R8701:Muc2 UTSW 7 141695607 missense probably damaging 1.00
R8883:Muc2 UTSW 7 141700900 missense probably damaging 0.98
R8894:Muc2 UTSW 7 141694515 missense probably damaging 1.00
R8905:Muc2 UTSW 7 141693400 missense probably benign 0.00
R9024:Muc2 UTSW 7 141701367 missense probably damaging 0.98
R9032:Muc2 UTSW 7 141700489 missense probably damaging 1.00
R9085:Muc2 UTSW 7 141700489 missense probably damaging 1.00
R9091:Muc2 UTSW 7 141704267 missense
R9104:Muc2 UTSW 7 141699655 missense probably damaging 1.00
R9114:Muc2 UTSW 7 141701414 nonsense probably null
R9270:Muc2 UTSW 7 141704267 missense
R9297:Muc2 UTSW 7 141749022 missense
R9325:Muc2 UTSW 7 141744822 missense
R9354:Muc2 UTSW 7 141753420 missense
R9386:Muc2 UTSW 7 141693146 missense probably damaging 1.00
R9529:Muc2 UTSW 7 141700884 missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141754505 missense probably damaging 1.00
R9583:Muc2 UTSW 7 141746822 missense
R9607:Muc2 UTSW 7 141751453 missense
R9646:Muc2 UTSW 7 141690400 missense probably benign
R9651:Muc2 UTSW 7 141701445 missense probably damaging 0.99
R9774:Muc2 UTSW 7 141699242 missense probably benign
R9784:Muc2 UTSW 7 141694542 nonsense probably null
Z1176:Muc2 UTSW 7 141746714 missense
Z1177:Muc2 UTSW 7 141744794 missense
Predicted Primers PCR Primer
(F):5'- AGTTGGAGTCTATTCCCTTTGC -3'
(R):5'- ACCATTTGAGAGCCTCAGGTC -3'

Sequencing Primer
(F):5'- GGAGTCTATTCCCTTTGCCCCTTC -3'
(R):5'- ATTTGAGAGCCTCAGGTCCCATG -3'
Posted On 2017-06-26