Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Muc2'

481314

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

044161-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R5979 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141751406 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 149 (G149D)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026590
AA Change: G149D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: G149D

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: G588D

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- AGTGCCCTTGAATGAACAGTTG -3'
(R):5'- TGGGCATGTTTGACTCACTAG -3'

Sequencing Primer
(F):5'- GAACAGTTGCTGGTCTGTCCC -3'
(R):5'- GTTTGACTCACTAGGAACATGAGTCC -3'

Posted On

2017-06-26