Incidental Mutation 'R5979:Adam3'
ID481315
Institutional Source Beutler Lab
Gene Symbol Adam3
Ensembl Gene ENSMUSG00000031553
Gene Namea disintegrin and metallopeptidase domain 3 (cyritestin)
SynonymsADAM3, Taz83, Taz83, Cyrn1, tMDC
MMRRC Submission 044161-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5979 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24677225-24725852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24677367 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 36 (N36S)
Ref Sequence ENSEMBL: ENSMUSP00000127479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000033958] [ENSMUST00000167431] [ENSMUST00000170318] [ENSMUST00000171438] [ENSMUST00000173833]
Predicted Effect probably benign
Transcript: ENSMUST00000033957
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033958
SMART Domains Protein: ENSMUSP00000033958
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 144 3.8e-30 PFAM
Pfam:Reprolysin_5 185 361 6.8e-9 PFAM
Pfam:Reprolysin 187 384 1.6e-64 PFAM
Pfam:Reprolysin_3 211 333 1.2e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158677
Predicted Effect probably benign
Transcript: ENSMUST00000167431
AA Change: N36S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127479
Gene: ENSMUSG00000031553
AA Change: N36S

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170318
SMART Domains Protein: ENSMUSP00000132620
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 118 1.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171438
SMART Domains Protein: ENSMUSP00000132651
Gene: ENSMUSG00000031553

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 23 144 2.4e-22 PFAM
Pfam:Reprolysin_5 185 361 7.8e-9 PFAM
Pfam:Reprolysin 187 384 4.1e-64 PFAM
Pfam:Reprolysin_3 211 321 1e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173833
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are male infertile, due to the inability of the sperm to bind to the zona pellucida. If the zona pellucida is removed sperm-egg membrane fusion happens as expected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Adam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Adam3 APN 8 24694278 missense probably damaging 1.00
IGL01792:Adam3 APN 8 24697203 missense probably benign 0.27
IGL01894:Adam3 APN 8 24687938 missense probably benign 0.33
IGL01941:Adam3 APN 8 24681446 utr 3 prime probably benign
IGL02355:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02362:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02511:Adam3 APN 8 24695176 missense probably damaging 0.98
IGL03070:Adam3 APN 8 24703784 missense probably damaging 1.00
IGL03106:Adam3 APN 8 24715119 splice site probably benign
IGL03238:Adam3 APN 8 24687965 splice site probably null
I2288:Adam3 UTSW 8 24684661 missense probably damaging 1.00
R0511:Adam3 UTSW 8 24695315 missense probably damaging 1.00
R1103:Adam3 UTSW 8 24714271 splice site probably benign
R1104:Adam3 UTSW 8 24681529 missense probably benign 0.10
R1430:Adam3 UTSW 8 24714271 splice site probably benign
R1599:Adam3 UTSW 8 24725361 missense possibly damaging 0.50
R1663:Adam3 UTSW 8 24687933 missense probably benign 0.03
R2023:Adam3 UTSW 8 24689463 missense possibly damaging 0.93
R2278:Adam3 UTSW 8 24711384 missense probably damaging 0.99
R3033:Adam3 UTSW 8 24694211 missense probably benign 0.00
R3440:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3441:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3688:Adam3 UTSW 8 24703848 missense probably benign 0.02
R4478:Adam3 UTSW 8 24695155 missense probably benign 0.04
R4654:Adam3 UTSW 8 24703803 missense probably damaging 1.00
R4811:Adam3 UTSW 8 24711724 missense probably benign 0.10
R4910:Adam3 UTSW 8 24694305 missense probably benign 0.03
R4921:Adam3 UTSW 8 24684614 missense probably benign 0.01
R4941:Adam3 UTSW 8 24677316 unclassified probably benign
R5239:Adam3 UTSW 8 24694191 missense possibly damaging 0.62
R5771:Adam3 UTSW 8 24707411 missense probably benign 0.00
R5897:Adam3 UTSW 8 24697228 missense probably benign 0.00
R5916:Adam3 UTSW 8 24684539 critical splice donor site probably null
R6168:Adam3 UTSW 8 24681614 splice site probably null
R6189:Adam3 UTSW 8 24711336 missense probably benign 0.01
R6801:Adam3 UTSW 8 24684664 missense possibly damaging 0.61
R6997:Adam3 UTSW 8 24681523 missense probably benign 0.10
R7065:Adam3 UTSW 8 24711675 critical splice donor site probably null
R7074:Adam3 UTSW 8 24694347 missense probably benign 0.01
R7151:Adam3 UTSW 8 24695255 missense probably damaging 1.00
R7208:Adam3 UTSW 8 24711401 missense probably damaging 0.98
R7341:Adam3 UTSW 8 24687980 missense possibly damaging 0.60
R7528:Adam3 UTSW 8 24677263 missense unknown
R7797:Adam3 UTSW 8 24694644 missense probably damaging 1.00
R7891:Adam3 UTSW 8 24707497 critical splice acceptor site probably null
R8064:Adam3 UTSW 8 24681550 missense probably benign 0.10
R8157:Adam3 UTSW 8 24707437 missense probably benign 0.27
R8229:Adam3 UTSW 8 24711738 missense probably damaging 0.98
X0063:Adam3 UTSW 8 24711706 missense probably damaging 0.96
Z1088:Adam3 UTSW 8 24681431 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- ACAGAGCTGGGATGTGATTG -3'
(R):5'- AATCATAGGCACAGAAGGCC -3'

Sequencing Primer
(F):5'- AGCTTAGAATGCTGATCTCCCTGG -3'
(R):5'- GAGAATGTAGCCTTTCTACTTC -3'
Posted On2017-06-26