Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Ankrd11'

481317

Institutional Source

Beutler Lab

Gene Symbol

Ankrd11

Ensembl Gene

ENSMUSG00000035569

Gene Name

ankyrin repeat domain 11

Synonyms

3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik

MMRRC Submission

044161-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5979 (G1)

Quality Score

163.009

Status

Validated

Chromosome

Chromosomal Location

122883822-123042277 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 122892400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1571 (D1571A)

Ref Sequence

ENSEMBL: ENSMUSP00000095938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]

AlphaFold

E9Q4F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000098333
AA Change: D1571A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: D1571A

Domain	Start	End	E-Value	Type
ANK	188	217	2.58e-3	SMART
ANK	221	250	1.31e-4	SMART
ANK	254	283	5.04e-6	SMART
low complexity region	311	324	N/A	INTRINSIC
low complexity region	366	377	N/A	INTRINSIC
low complexity region	429	440	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	499	521	N/A	INTRINSIC
low complexity region	534	549	N/A	INTRINSIC
low complexity region	596	609	N/A	INTRINSIC
low complexity region	649	669	N/A	INTRINSIC
coiled coil region	786	826	N/A	INTRINSIC
low complexity region	867	877	N/A	INTRINSIC
low complexity region	965	984	N/A	INTRINSIC
low complexity region	1040	1055	N/A	INTRINSIC
low complexity region	1058	1082	N/A	INTRINSIC
low complexity region	1187	1200	N/A	INTRINSIC
low complexity region	1204	1227	N/A	INTRINSIC
low complexity region	1268	1289	N/A	INTRINSIC
low complexity region	1294	1306	N/A	INTRINSIC
coiled coil region	1374	1406	N/A	INTRINSIC
low complexity region	1476	1496	N/A	INTRINSIC
low complexity region	1508	1523	N/A	INTRINSIC
low complexity region	1526	1547	N/A	INTRINSIC
coiled coil region	1598	1625	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1874	1885	N/A	INTRINSIC
low complexity region	1913	1922	N/A	INTRINSIC
low complexity region	1969	1979	N/A	INTRINSIC
low complexity region	2035	2045	N/A	INTRINSIC
low complexity region	2057	2071	N/A	INTRINSIC
low complexity region	2162	2179	N/A	INTRINSIC
low complexity region	2191	2209	N/A	INTRINSIC
low complexity region	2224	2236	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC
low complexity region	2294	2305	N/A	INTRINSIC
low complexity region	2391	2409	N/A	INTRINSIC
low complexity region	2445	2455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098334
AA Change: D1550A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: D1550A

Domain	Start	End	E-Value	Type
ANK	167	196	2.58e-3	SMART
ANK	200	229	1.31e-4	SMART
ANK	233	262	5.04e-6	SMART
low complexity region	290	303	N/A	INTRINSIC
low complexity region	345	356	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
low complexity region	449	466	N/A	INTRINSIC
low complexity region	478	500	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	575	588	N/A	INTRINSIC
low complexity region	628	648	N/A	INTRINSIC
coiled coil region	765	805	N/A	INTRINSIC
low complexity region	846	856	N/A	INTRINSIC
low complexity region	944	963	N/A	INTRINSIC
low complexity region	1019	1034	N/A	INTRINSIC
low complexity region	1037	1061	N/A	INTRINSIC
low complexity region	1166	1179	N/A	INTRINSIC
low complexity region	1183	1206	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1273	1285	N/A	INTRINSIC
coiled coil region	1353	1385	N/A	INTRINSIC
low complexity region	1455	1475	N/A	INTRINSIC
low complexity region	1487	1502	N/A	INTRINSIC
low complexity region	1505	1526	N/A	INTRINSIC
coiled coil region	1577	1604	N/A	INTRINSIC
low complexity region	1749	1760	N/A	INTRINSIC
low complexity region	1853	1864	N/A	INTRINSIC
low complexity region	1892	1901	N/A	INTRINSIC
low complexity region	1948	1958	N/A	INTRINSIC
low complexity region	2014	2024	N/A	INTRINSIC
low complexity region	2036	2050	N/A	INTRINSIC
low complexity region	2141	2158	N/A	INTRINSIC
low complexity region	2170	2188	N/A	INTRINSIC
low complexity region	2203	2215	N/A	INTRINSIC
low complexity region	2229	2242	N/A	INTRINSIC
low complexity region	2273	2284	N/A	INTRINSIC
low complexity region	2370	2388	N/A	INTRINSIC
low complexity region	2424	2434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211940

Predicted Effect

probably benign
Transcript: ENSMUST00000212050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212337

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212728

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Ankrd11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ankrd11	APN	8	122908728	missense	possibly damaging	0.59
IGL00971:Ankrd11	APN	8	122895353	missense	probably damaging	1.00
IGL01017:Ankrd11	APN	8	122894728	missense	probably damaging	1.00
IGL01137:Ankrd11	APN	8	122884336	missense	probably damaging	0.99
IGL01659:Ankrd11	APN	8	122895371	missense	probably damaging	1.00
IGL01920:Ankrd11	APN	8	122915897	splice site	probably benign
IGL01964:Ankrd11	APN	8	122889736	missense	probably damaging	0.97
IGL02131:Ankrd11	APN	8	122894410	missense	probably damaging	1.00
IGL02226:Ankrd11	APN	8	122892245	missense	probably damaging	1.00
IGL02549:Ankrd11	APN	8	122891293	missense	probably damaging	1.00
IGL02642:Ankrd11	APN	8	122890651	missense	probably damaging	1.00
IGL02643:Ankrd11	APN	8	122892322	missense	probably damaging	0.98
IGL02861:Ankrd11	APN	8	122895827	missense	probably damaging	0.99
IGL03086:Ankrd11	APN	8	122894510	missense	probably damaging	1.00
IGL03336:Ankrd11	APN	8	122891843	missense	probably benign	0.00
anchors	UTSW	8	122895770	missense	probably damaging	0.99
away	UTSW	8	122891953	missense	probably damaging	1.00
bluebell	UTSW	8	122891785	missense	probably damaging	0.97
Navy	UTSW	8	122908734	nonsense	probably null
BB001:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
BB011:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0110:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0281:Ankrd11	UTSW	8	122895568	missense	probably benign	0.01
R0450:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0481:Ankrd11	UTSW	8	122900036	missense	probably damaging	1.00
R0542:Ankrd11	UTSW	8	122895770	missense	probably damaging	0.99
R0606:Ankrd11	UTSW	8	122892832	missense	probably benign	0.04
R0702:Ankrd11	UTSW	8	122889766	missense	probably damaging	1.00
R0730:Ankrd11	UTSW	8	122891953	missense	probably damaging	1.00
R0737:Ankrd11	UTSW	8	122895836	missense	probably damaging	0.99
R1401:Ankrd11	UTSW	8	122893050	missense	probably benign	0.23
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1641:Ankrd11	UTSW	8	122891746	missense	probably benign	0.03
R1950:Ankrd11	UTSW	8	122889869	missense	probably damaging	1.00
R2004:Ankrd11	UTSW	8	122902422	critical splice donor site	probably null
R2401:Ankrd11	UTSW	8	122908734	nonsense	probably null
R2425:Ankrd11	UTSW	8	122893163	missense	possibly damaging	0.86
R2830:Ankrd11	UTSW	8	122892196	missense	probably damaging	1.00
R2910:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R2911:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R3736:Ankrd11	UTSW	8	122891785	missense	probably damaging	0.97
R3738:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3739:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3813:Ankrd11	UTSW	8	122891378	missense	probably benign
R4012:Ankrd11	UTSW	8	122892417	missense	probably damaging	0.98
R4183:Ankrd11	UTSW	8	122899676	missense	possibly damaging	0.88
R4213:Ankrd11	UTSW	8	122891026	missense	probably benign	0.00
R4469:Ankrd11	UTSW	8	122896587	missense	probably damaging	1.00
R4482:Ankrd11	UTSW	8	122893489	missense	probably damaging	1.00
R4935:Ankrd11	UTSW	8	122900183	missense	probably benign	0.02
R4940:Ankrd11	UTSW	8	122889821	missense	probably damaging	1.00
R5145:Ankrd11	UTSW	8	122891204	utr 3 prime	probably benign
R5154:Ankrd11	UTSW	8	122893139	missense	probably damaging	1.00
R5230:Ankrd11	UTSW	8	122890477	missense	probably benign	0.11
R5283:Ankrd11	UTSW	8	122884182	missense	probably damaging	1.00
R5377:Ankrd11	UTSW	8	122893714	splice site	probably null
R5513:Ankrd11	UTSW	8	122892520	missense	probably benign	0.38
R5518:Ankrd11	UTSW	8	122890994	missense	possibly damaging	0.93
R5549:Ankrd11	UTSW	8	122890378	missense	probably benign	0.02
R5579:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R5595:Ankrd11	UTSW	8	122894304	nonsense	probably null
R5650:Ankrd11	UTSW	8	122887397	missense	probably damaging	0.99
R5717:Ankrd11	UTSW	8	122892638	missense	possibly damaging	0.92
R5753:Ankrd11	UTSW	8	122895304	missense	possibly damaging	0.90
R5782:Ankrd11	UTSW	8	122900017	missense	probably damaging	1.00
R5812:Ankrd11	UTSW	8	122893805	splice site	probably null
R5823:Ankrd11	UTSW	8	122895790	missense	probably benign	0.12
R5900:Ankrd11	UTSW	8	122891066	missense	probably benign	0.00
R5975:Ankrd11	UTSW	8	122889749	missense	possibly damaging	0.93
R6000:Ankrd11	UTSW	8	122891195	missense	possibly damaging	0.73
R6145:Ankrd11	UTSW	8	122892661	missense	probably damaging	1.00
R6252:Ankrd11	UTSW	8	122893822	missense	possibly damaging	0.87
R6302:Ankrd11	UTSW	8	122889989	missense	probably benign
R6457:Ankrd11	UTSW	8	122908764	missense	probably damaging	1.00
R6513:Ankrd11	UTSW	8	122890180	missense	probably benign	0.02
R6582:Ankrd11	UTSW	8	122891629	missense	probably benign	0.00
R6738:Ankrd11	UTSW	8	122891921	missense	probably damaging	0.99
R6865:Ankrd11	UTSW	8	122894944	missense	probably benign	0.41
R6913:Ankrd11	UTSW	8	122894911	missense	probably benign	0.01
R7101:Ankrd11	UTSW	8	122895455	missense	probably benign	0.35
R7116:Ankrd11	UTSW	8	122896130	missense	probably damaging	1.00
R7477:Ankrd11	UTSW	8	122894385	missense	possibly damaging	0.91
R7534:Ankrd11	UTSW	8	122894410	missense	probably damaging	1.00
R7555:Ankrd11	UTSW	8	122887406	missense	probably damaging	0.99
R7627:Ankrd11	UTSW	8	122890951	missense	possibly damaging	0.63
R7658:Ankrd11	UTSW	8	122893664	missense	probably benign
R7721:Ankrd11	UTSW	8	122894759	missense	probably damaging	1.00
R7731:Ankrd11	UTSW	8	122895433	missense	probably benign	0.12
R7792:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R7924:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R7939:Ankrd11	UTSW	8	122891073	missense	probably damaging	1.00
R8022:Ankrd11	UTSW	8	122887593	missense	probably damaging	1.00
R8222:Ankrd11	UTSW	8	122895608	missense	probably damaging	0.98
R8362:Ankrd11	UTSW	8	122892058	missense	probably damaging	0.96
R8430:Ankrd11	UTSW	8	122893366	missense	probably benign	0.01
R8511:Ankrd11	UTSW	8	122899729	missense
R8726:Ankrd11	UTSW	8	122894026	missense	possibly damaging	0.90
R8888:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8895:Ankrd11	UTSW	8	122894275	missense	possibly damaging	0.87
R8928:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8930:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8931:Ankrd11	UTSW	8	122895979	missense	probably damaging	0.99
R8936:Ankrd11	UTSW	8	122895101	missense	possibly damaging	0.69
R9018:Ankrd11	UTSW	8	122895512	missense	probably damaging	1.00
R9113:Ankrd11	UTSW	8	122887333	missense	possibly damaging	0.60
R9399:Ankrd11	UTSW	8	122891440	missense	probably benign
R9644:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9645:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9647:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
R9683:Ankrd11	UTSW	8	122890943	missense	probably benign	0.00
RF019:Ankrd11	UTSW	8	122896634	missense	probably damaging	1.00
Z1176:Ankrd11	UTSW	8	122895803	missense	possibly damaging	0.68
Z1177:Ankrd11	UTSW	8	122900142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGTCCAGGCTCTTCTTGCG -3'
(R):5'- GCTTCCTGAGACACCACAAG -3'

Sequencing Primer
(F):5'- CTCTTTGAGCTTGGGGTCTCC -3'
(R):5'- GACGAGCCAAAGCCTGCAG -3'

Posted On

2017-06-26