Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Nlrp3'

481326

Institutional Source

Beutler Lab

Gene Symbol

Nlrp3

Ensembl Gene

ENSMUSG00000032691

Gene Name

NLR family, pyrin domain containing 3

Synonyms

Cias1, cryopyrin, Pypaf1, NALP3, Mmig1

MMRRC Submission

044161-MU

Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5979 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59541568-59566956 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59548971 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 458 (F458S)

Ref Sequence

ENSEMBL: ENSMUSP00000098707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]

AlphaFold

Q8R4B8

Predicted Effect

probably benign
Transcript: ENSMUST00000079476
AA Change: F458S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: F458S

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101148
AA Change: F458S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: F458S

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149126

SMART Domains

Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Nlrp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nlrp3	APN	11	59565943	missense	probably damaging	0.99
IGL00573:Nlrp3	APN	11	59565116	missense	possibly damaging	0.93
IGL01025:Nlrp3	APN	11	59551887	missense	probably benign	0.21
IGL01637:Nlrp3	APN	11	59549378	missense	probably damaging	0.99
IGL02010:Nlrp3	APN	11	59549535	missense	probably benign
IGL02334:Nlrp3	APN	11	59565083	missense	probably benign
IGL02417:Nlrp3	APN	11	59566023	unclassified	probably benign
IGL02578:Nlrp3	APN	11	59548401	missense	probably damaging	1.00
IGL02710:Nlrp3	APN	11	59565976	missense	probably damaging	0.99
IGL02816:Nlrp3	APN	11	59555782	missense	probably benign	0.03
IGL03157:Nlrp3	APN	11	59549546	missense	possibly damaging	0.80
IGL03334:Nlrp3	APN	11	59549016	missense	probably damaging	1.00
Flogiston	UTSW	11	59558448	missense	probably benign	0.00
nd1	UTSW	11	59565974	missense	probably benign	0.45
Nd14	UTSW	11	59555875	missense	possibly damaging	0.89
Nd3	UTSW	11	59565974	missense	probably benign	0.45
nd5	UTSW	11	59565879	missense	probably benign	0.01
nd6	UTSW	11	59549354	missense	probably damaging	1.00
nd7	UTSW	11	59555875	missense	possibly damaging	0.89
Nd9	UTSW	11	59549354	missense	probably damaging	1.00
Park2	UTSW	11	59565128	nonsense	probably null
Park3	UTSW	11	59565850	missense	probably benign	0.02
Park4	UTSW	11	59549531	missense	probably benign	0.19
Park5	UTSW	11	59548476	missense	probably damaging	0.99
Park6	UTSW	11	59549036	missense	probably damaging	1.00
Park7	UTSW	11	59548010	nonsense	probably null
Park8	UTSW	11	59566199	missense	probably benign	0.19
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0052:Nlrp3	UTSW	11	59565128	nonsense	probably null
R0362:Nlrp3	UTSW	11	59548797	missense	possibly damaging	0.49
R0416:Nlrp3	UTSW	11	59555924	splice site	probably benign
R0649:Nlrp3	UTSW	11	59548542	missense	possibly damaging	0.83
R0740:Nlrp3	UTSW	11	59548256	missense	probably benign	0.01
R0863:Nlrp3	UTSW	11	59565850	missense	probably benign	0.02
R1300:Nlrp3	UTSW	11	59555768	missense	possibly damaging	0.86
R1414:Nlrp3	UTSW	11	59549531	missense	probably benign	0.19
R1622:Nlrp3	UTSW	11	59548476	missense	probably damaging	0.99
R1654:Nlrp3	UTSW	11	59543123	missense	probably benign	0.03
R1715:Nlrp3	UTSW	11	59543351	missense	probably damaging	1.00
R1754:Nlrp3	UTSW	11	59558402	missense	possibly damaging	0.80
R1837:Nlrp3	UTSW	11	59548916	missense	probably benign	0.00
R1905:Nlrp3	UTSW	11	59549036	missense	probably damaging	1.00
R2281:Nlrp3	UTSW	11	59549136	missense	possibly damaging	0.70
R4296:Nlrp3	UTSW	11	59549661	missense	possibly damaging	0.89
R4305:Nlrp3	UTSW	11	59548010	nonsense	probably null
R4540:Nlrp3	UTSW	11	59551899	missense	possibly damaging	0.83
R4591:Nlrp3	UTSW	11	59549222	missense	probably benign	0.00
R4816:Nlrp3	UTSW	11	59548301	missense	probably benign	0.32
R4913:Nlrp3	UTSW	11	59549238	missense	probably benign	0.09
R4970:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5051:Nlrp3	UTSW	11	59566199	missense	probably benign	0.19
R5112:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5185:Nlrp3	UTSW	11	59565084	missense	probably benign	0.05
R5417:Nlrp3	UTSW	11	59549063	missense	probably damaging	1.00
R5709:Nlrp3	UTSW	11	59555748	nonsense	probably null
R5869:Nlrp3	UTSW	11	59548134	missense	probably damaging	1.00
R5898:Nlrp3	UTSW	11	59546852	missense	probably benign	0.00
R5953:Nlrp3	UTSW	11	59546791	missense	probably benign
R6359:Nlrp3	UTSW	11	59548566	missense	probably damaging	0.97
R6723:Nlrp3	UTSW	11	59565192	missense	probably damaging	1.00
R7261:Nlrp3	UTSW	11	59548446	missense	possibly damaging	0.83
R7349:Nlrp3	UTSW	11	59548086	missense	probably damaging	1.00
R7388:Nlrp3	UTSW	11	59565066	missense	probably benign	0.00
R7715:Nlrp3	UTSW	11	59543003	splice site	probably null
R7916:Nlrp3	UTSW	11	59551863	missense	probably benign	0.00
R8222:Nlrp3	UTSW	11	59548788	missense	probably damaging	0.98
R8360:Nlrp3	UTSW	11	59549403	missense	probably benign	0.02
R8390:Nlrp3	UTSW	11	59551790	missense	possibly damaging	0.47
R8550:Nlrp3	UTSW	11	59549271	missense	probably damaging	1.00
R8738:Nlrp3	UTSW	11	59549390	missense	probably benign	0.00
R8940:Nlrp3	UTSW	11	59565044	missense	probably benign	0.26
R8990:Nlrp3	UTSW	11	59548758	missense	probably damaging	0.99
R9324:Nlrp3	UTSW	11	59543315	missense	probably damaging	1.00
R9673:Nlrp3	UTSW	11	59549322	missense	probably damaging	1.00
RF031:Nlrp3	UTSW	11	59558552	frame shift	probably null
RF040:Nlrp3	UTSW	11	59558552	frame shift	probably null
Z1088:Nlrp3	UTSW	11	59551860	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- GCTGATCCAAGAGAATGAGGTCC -3'
(R):5'- AGCGAAGAACTCCTGGAAAGTC -3'

Sequencing Primer
(F):5'- TCCAAGAGAATGAGGTCCTCTTTACC -3'
(R):5'- ACTCCTGGAAAGTCATGTGGC -3'

Posted On

2017-06-26