Incidental Mutation 'R5979:Nlrp3'
ID 481326
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59439797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 458 (F458S)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably benign
Transcript: ENSMUST00000079476
AA Change: F458S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: F458S

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101148
AA Change: F458S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: F458S

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCTGATCCAAGAGAATGAGGTCC -3'
(R):5'- AGCGAAGAACTCCTGGAAAGTC -3'

Sequencing Primer
(F):5'- TCCAAGAGAATGAGGTCCTCTTTACC -3'
(R):5'- ACTCCTGGAAAGTCATGTGGC -3'
Posted On 2017-06-26