Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Parn'

481338

Institutional Source

Beutler Lab

Gene Symbol

Parn

Ensembl Gene

ENSMUSG00000022685

Gene Name

poly(A)-specific ribonuclease (deadenylation nuclease)

Synonyms

DAN, 1200003I18Rik

MMRRC Submission

044161-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R5979 (G1)

Quality Score

207.009

Status

Validated

Chromosome

Chromosomal Location

13537960-13668170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 13606171 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 454 (L454R)

Ref Sequence

ENSEMBL: ENSMUSP00000055969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000058884
AA Change: L454R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: L454R

Domain	Start	End	E-Value	Type
Pfam:CAF1	3	383	2.7e-86	PFAM
Pfam:R3H	172	236	2.8e-13	PFAM
Pfam:RNA_bind	430	508	2.2e-37	PFAM
low complexity region	564	578	N/A	INTRINSIC
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231003

Meta Mutation Damage Score

0.9060

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Parn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Parn	APN	16	13667603	missense	probably benign
IGL02030:Parn	APN	16	13664650	splice site	probably null
IGL02179:Parn	APN	16	13667592	missense	probably benign	0.00
IGL02336:Parn	APN	16	13566703	missense	probably damaging	1.00
arlette	UTSW	16	13606171	missense	probably damaging	1.00
PIT4453001:Parn	UTSW	16	13607281	missense	probably benign	0.00
PIT4651001:Parn	UTSW	16	13631567	missense	probably benign	0.25
R0388:Parn	UTSW	16	13654476	missense	possibly damaging	0.72
R0485:Parn	UTSW	16	13654435	splice site	probably benign
R0625:Parn	UTSW	16	13640294	missense	probably benign	0.02
R1104:Parn	UTSW	16	13667585	missense	probably damaging	0.99
R1299:Parn	UTSW	16	13664729	missense	probably benign	0.10
R1356:Parn	UTSW	16	13650674	nonsense	probably null
R2067:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2111:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2397:Parn	UTSW	16	13566654	missense	probably benign
R4473:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4474:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4475:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4476:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4665:Parn	UTSW	16	13541103	missense	probably benign	0.19
R4795:Parn	UTSW	16	13606202	missense	probably benign	0.06
R5122:Parn	UTSW	16	13654447	critical splice donor site	probably null
R5226:Parn	UTSW	16	13625552	missense	probably benign
R5355:Parn	UTSW	16	13668022	missense	possibly damaging	0.92
R5570:Parn	UTSW	16	13665930	missense	probably damaging	0.98
R6009:Parn	UTSW	16	13667564	missense	probably damaging	1.00
R6173:Parn	UTSW	16	13651811	missense	possibly damaging	0.82
R6493:Parn	UTSW	16	13656925	missense	probably damaging	1.00
R7055:Parn	UTSW	16	13626134	missense	possibly damaging	0.80
R7278:Parn	UTSW	16	13626063	splice site	probably null
R7391:Parn	UTSW	16	13668006	splice site	probably null
R7706:Parn	UTSW	16	13607253	missense	probably damaging	1.00
R8188:Parn	UTSW	16	13541156	missense	probably benign	0.01
R8317:Parn	UTSW	16	13541100	missense	probably damaging	0.96
R8326:Parn	UTSW	16	13665971	missense	probably benign	0.00
R8419:Parn	UTSW	16	13648474	missense	probably benign	0.11
R8433:Parn	UTSW	16	13667549	missense	probably damaging	1.00
R8475:Parn	UTSW	16	13607249	critical splice donor site	probably null
R8847:Parn	UTSW	16	13628406	nonsense	probably null
R8958:Parn	UTSW	16	13648458	missense	possibly damaging	0.64
R8988:Parn	UTSW	16	13648417	critical splice donor site	probably null
R9277:Parn	UTSW	16	13664655	critical splice donor site	probably null
R9476:Parn	UTSW	16	13541078	missense	probably benign	0.10
R9510:Parn	UTSW	16	13541078	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TTGGACTCTGCTAGCAAAGG -3'
(R):5'- AAATCCCTGCTTTGCTTTGG -3'

Sequencing Primer
(F):5'- GGCTATACAATGCACCTCAGATC -3'
(R):5'- CACATCTACCTGTTTTAATGGGG -3'

Posted On

2017-06-26