Incidental Mutation 'R5979:Parn'
ID481338
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Namepoly(A)-specific ribonuclease (deadenylation nuclease)
SynonymsDAN, 1200003I18Rik
MMRRC Submission 044161-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5979 (G1)
Quality Score207.009
Status Validated
Chromosome16
Chromosomal Location13537960-13668170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13606171 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 454 (L454R)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]
Predicted Effect probably damaging
Transcript: ENSMUST00000058884
AA Change: L454R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: L454R

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231003
Meta Mutation Damage Score 0.9060 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4474:Parn UTSW 16 13664685 missense probably benign 0.00
R4475:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R4795:Parn UTSW 16 13606202 missense probably benign 0.06
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5226:Parn UTSW 16 13625552 missense probably benign
R5355:Parn UTSW 16 13668022 missense possibly damaging 0.92
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 intron probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGACTCTGCTAGCAAAGG -3'
(R):5'- AAATCCCTGCTTTGCTTTGG -3'

Sequencing Primer
(F):5'- GGCTATACAATGCACCTCAGATC -3'
(R):5'- CACATCTACCTGTTTTAATGGGG -3'
Posted On2017-06-26