Incidental Mutation 'R5979:Zfp213'
ID481343
Institutional Source Beutler Lab
Gene Symbol Zfp213
Ensembl Gene ENSMUSG00000071256
Gene Namezinc finger protein 213
SynonymsD17Ertd197e
MMRRC Submission 044161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5979 (G1)
Quality Score151.008
Status Validated
Chromosome17
Chromosomal Location23556769-23564226 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 23557911 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 386 (E386*)
Ref Sequence ENSEMBL: ENSMUSP00000093266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088673] [ENSMUST00000095606] [ENSMUST00000182769]
Predicted Effect probably benign
Transcript: ENSMUST00000088673
SMART Domains Protein: ENSMUSP00000086048
Gene: ENSMUSG00000067882

DomainStartEndE-ValueType
Pfam:Peptidase_C14 3 162 4.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095606
AA Change: E386*
SMART Domains Protein: ENSMUSP00000093266
Gene: ENSMUSG00000071256
AA Change: E386*

DomainStartEndE-ValueType
SCAN 41 145 3.11e-56 SMART
KRAB 213 278 3.21e-4 SMART
ZnF_C2H2 326 348 3.89e-3 SMART
ZnF_C2H2 354 376 9.88e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.95e-3 SMART
ZnF_C2H2 438 460 4.4e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180920
Predicted Effect probably benign
Transcript: ENSMUST00000182769
SMART Domains Protein: ENSMUSP00000138283
Gene: ENSMUSG00000067882

DomainStartEndE-ValueType
Pfam:Peptidase_C14 18 175 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2H2 zinc finger proteins, such as ZNF213, have bipartite structures in which one domain binds DNA or RNA and the other modulates target gene expression.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Other mutations in Zfp213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp213 APN 17 23561417 missense probably benign 0.18
IGL02302:Zfp213 APN 17 23557971 missense possibly damaging 0.88
ANU18:Zfp213 UTSW 17 23561417 missense probably benign 0.18
R2137:Zfp213 UTSW 17 23559507 synonymous probably null
R4010:Zfp213 UTSW 17 23558090 missense possibly damaging 0.93
R5149:Zfp213 UTSW 17 23561399 missense probably damaging 0.97
R5595:Zfp213 UTSW 17 23561186 missense possibly damaging 0.92
R6227:Zfp213 UTSW 17 23558022 missense probably benign 0.16
R6711:Zfp213 UTSW 17 23559511 missense probably benign
R7105:Zfp213 UTSW 17 23558204 missense probably benign 0.40
R7409:Zfp213 UTSW 17 23559629 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGCTGCTTGAAACTCTTGTC -3'
(R):5'- TTCAGAACTTATTGGCGGAGAAG -3'

Sequencing Primer
(F):5'- GCTTGAAACTCTTGTCACACTC -3'
(R):5'- GAGAAGCCCCACAGCTG -3'
Posted On2017-06-26