Incidental Mutation 'R5979:Skic2'
ID 481346
Institutional Source Beutler Lab
Gene Symbol Skic2
Ensembl Gene ENSMUSG00000040356
Gene Name SKI2 subunit of superkiller complex
Synonyms 4930534J06Rik, Ski2w, Skiv2l
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5979 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 35058202-35069180 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35060439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 851 (N851K)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000046244] [ENSMUST00000077477] [ENSMUST00000159333] [ENSMUST00000161885] [ENSMUST00000173874] [ENSMUST00000173063] [ENSMUST00000173415] [ENSMUST00000173768] [ENSMUST00000172612] [ENSMUST00000180043] [ENSMUST00000174092] [ENSMUST00000173995]
AlphaFold Q6NZR5
Predicted Effect probably benign
Transcript: ENSMUST00000046022
AA Change: N851K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: N851K

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046244
SMART Domains Protein: ENSMUSP00000047018
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077477
SMART Domains Protein: ENSMUSP00000076686
Gene: ENSMUSG00000061207

DomainStartEndE-ValueType
Pfam:Stk19 37 251 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159333
SMART Domains Protein: ENSMUSP00000125311
Gene: ENSMUSG00000061207

DomainStartEndE-ValueType
Pfam:Stk19 1 129 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172803
Predicted Effect probably benign
Transcript: ENSMUST00000161885
Predicted Effect probably benign
Transcript: ENSMUST00000173874
SMART Domains Protein: ENSMUSP00000134332
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 4.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173063
Predicted Effect probably benign
Transcript: ENSMUST00000173415
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173768
SMART Domains Protein: ENSMUSP00000134052
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 1 33 5.6e-15 PFAM
low complexity region 54 64 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172612
SMART Domains Protein: ENSMUSP00000133376
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 5 73 1.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect probably benign
Transcript: ENSMUST00000180043
SMART Domains Protein: ENSMUSP00000137234
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 302 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174569
SMART Domains Protein: ENSMUSP00000133448
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 15 65 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174092
SMART Domains Protein: ENSMUSP00000133587
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 110 151 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174684
SMART Domains Protein: ENSMUSP00000134653
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 2 48 1e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000173995
SMART Domains Protein: ENSMUSP00000134583
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 1 144 5e-99 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nrxn1 C T 17: 91,395,631 (GRCm39) R175H possibly damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Skic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skic2 APN 17 35,058,524 (GRCm39) missense probably damaging 1.00
IGL00338:Skic2 APN 17 35,065,643 (GRCm39) missense probably damaging 0.99
IGL01284:Skic2 APN 17 35,058,664 (GRCm39) unclassified probably benign
IGL01308:Skic2 APN 17 35,059,610 (GRCm39) missense probably benign 0.19
IGL01874:Skic2 APN 17 35,060,185 (GRCm39) missense probably benign
IGL02114:Skic2 APN 17 35,060,092 (GRCm39) missense probably damaging 0.97
IGL02208:Skic2 APN 17 35,060,651 (GRCm39) missense probably damaging 0.99
IGL02274:Skic2 APN 17 35,064,839 (GRCm39) missense probably damaging 1.00
IGL02729:Skic2 APN 17 35,058,581 (GRCm39) missense possibly damaging 0.63
IGL02839:Skic2 APN 17 35,066,774 (GRCm39) missense probably benign
R0325:Skic2 UTSW 17 35,063,791 (GRCm39) missense possibly damaging 0.50
R1102:Skic2 UTSW 17 35,059,082 (GRCm39) missense probably benign 0.28
R1294:Skic2 UTSW 17 35,060,040 (GRCm39) splice site probably null
R1513:Skic2 UTSW 17 35,066,420 (GRCm39) missense probably damaging 1.00
R1557:Skic2 UTSW 17 35,067,398 (GRCm39) missense probably damaging 1.00
R1747:Skic2 UTSW 17 35,066,782 (GRCm39) missense probably benign 0.02
R2401:Skic2 UTSW 17 35,059,361 (GRCm39) missense probably benign
R3162:Skic2 UTSW 17 35,066,789 (GRCm39) nonsense probably null
R3162:Skic2 UTSW 17 35,066,789 (GRCm39) nonsense probably null
R3695:Skic2 UTSW 17 35,066,888 (GRCm39) missense probably damaging 1.00
R3700:Skic2 UTSW 17 35,068,879 (GRCm39) missense probably benign
R4654:Skic2 UTSW 17 35,068,922 (GRCm39) missense probably damaging 1.00
R4736:Skic2 UTSW 17 35,067,173 (GRCm39) missense possibly damaging 0.91
R4835:Skic2 UTSW 17 35,061,897 (GRCm39) missense possibly damaging 0.66
R5014:Skic2 UTSW 17 35,066,401 (GRCm39) missense probably benign 0.00
R5181:Skic2 UTSW 17 35,063,802 (GRCm39) missense probably benign 0.44
R5223:Skic2 UTSW 17 35,064,142 (GRCm39) critical splice donor site probably null
R5417:Skic2 UTSW 17 35,065,574 (GRCm39) missense probably damaging 0.98
R5623:Skic2 UTSW 17 35,066,408 (GRCm39) missense probably benign 0.00
R5878:Skic2 UTSW 17 35,065,093 (GRCm39) missense possibly damaging 0.83
R6412:Skic2 UTSW 17 35,059,276 (GRCm39) missense possibly damaging 0.92
R6501:Skic2 UTSW 17 35,063,412 (GRCm39) missense possibly damaging 0.95
R6532:Skic2 UTSW 17 35,063,719 (GRCm39) missense probably damaging 1.00
R6730:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6732:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6741:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6742:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6769:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R6771:Skic2 UTSW 17 35,064,166 (GRCm39) nonsense probably null
R7022:Skic2 UTSW 17 35,064,183 (GRCm39) missense possibly damaging 0.88
R7096:Skic2 UTSW 17 35,060,446 (GRCm39) missense probably benign
R7178:Skic2 UTSW 17 35,058,440 (GRCm39) missense probably benign
R7315:Skic2 UTSW 17 35,060,145 (GRCm39) missense probably benign 0.00
R7584:Skic2 UTSW 17 35,060,651 (GRCm39) missense possibly damaging 0.69
R7677:Skic2 UTSW 17 35,067,140 (GRCm39) missense probably benign 0.03
R7796:Skic2 UTSW 17 35,063,394 (GRCm39) missense probably damaging 1.00
R8071:Skic2 UTSW 17 35,068,975 (GRCm39) missense probably benign 0.22
R8407:Skic2 UTSW 17 35,060,103 (GRCm39) missense probably benign 0.00
R8991:Skic2 UTSW 17 35,059,166 (GRCm39) missense probably damaging 1.00
R9016:Skic2 UTSW 17 35,063,640 (GRCm39) missense probably damaging 0.98
R9021:Skic2 UTSW 17 35,065,579 (GRCm39) missense probably damaging 1.00
R9196:Skic2 UTSW 17 35,068,877 (GRCm39) missense probably benign 0.00
R9243:Skic2 UTSW 17 35,064,198 (GRCm39) missense probably benign 0.33
R9322:Skic2 UTSW 17 35,066,439 (GRCm39) critical splice acceptor site probably null
R9475:Skic2 UTSW 17 35,060,078 (GRCm39) missense probably benign
R9564:Skic2 UTSW 17 35,063,758 (GRCm39) missense probably benign
R9565:Skic2 UTSW 17 35,063,758 (GRCm39) missense probably benign
Z1176:Skic2 UTSW 17 35,060,522 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCACGCCAAGCAATTAGAG -3'
(R):5'- GACCCAGAACATGATCCAGG -3'

Sequencing Primer
(F):5'- TTAGAGCAGCTTGAGGGCC -3'
(R):5'- CCCAGAACATGATCCAGGTGAGTG -3'
Posted On 2017-06-26