Incidental Mutation 'R5979:Nrxn1'
ID 481349
Institutional Source Beutler Lab
Gene Symbol Nrxn1
Ensembl Gene ENSMUSG00000024109
Gene Name neurexin I
Synonyms alpha-latrotoxin receptor (calcium-dependent), 1700062G21Rik, neurexin I alpha, neurexin I alpha, 9330127H16Rik, neurexin I beta, neurexin I beta, A230068P09Rik, neurexin I alpha, neurexin I beta
MMRRC Submission 044161-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5979 (G1)
Quality Score 112.008
Status Validated
Chromosome 17
Chromosomal Location 90341059-91400499 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 91395631 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 175 (R175H)
Ref Sequence ENSEMBL: ENSMUSP00000133491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054059] [ENSMUST00000072671] [ENSMUST00000095183] [ENSMUST00000160800] [ENSMUST00000160844] [ENSMUST00000161402] [ENSMUST00000174331]
AlphaFold Q9CS84
Predicted Effect possibly damaging
Transcript: ENSMUST00000054059
AA Change: R175H

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057294
Gene: ENSMUSG00000024109
AA Change: R175H

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
4.1m 1444 1462 1.19e-6 SMART
low complexity region 1481 1493 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072671
AA Change: R175H

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072458
Gene: ENSMUSG00000024109
AA Change: R175H

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1423 1438 N/A INTRINSIC
4.1m 1441 1459 1.19e-6 SMART
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095183
SMART Domains Protein: ENSMUSP00000092806
Gene: ENSMUSG00000071033

DomainStartEndE-ValueType
low complexity region 1 40 N/A INTRINSIC
low complexity region 47 61 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160467
Predicted Effect probably benign
Transcript: ENSMUST00000160800
AA Change: R175H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124561
Gene: ENSMUSG00000024109
AA Change: R175H

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 300 434 2.3e-36 SMART
LamG 488 640 2.74e-43 SMART
EGF 667 701 1.58e-3 SMART
LamG 726 865 7.27e-25 SMART
LamG 913 1049 8.46e-35 SMART
EGF 1074 1108 1.87e1 SMART
LamG 1136 1293 7.74e-20 SMART
low complexity region 1320 1351 N/A INTRINSIC
low complexity region 1422 1437 N/A INTRINSIC
4.1m 1440 1458 1.19e-6 SMART
low complexity region 1477 1489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160844
AA Change: R175H

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125407
Gene: ENSMUSG00000024109
AA Change: R175H

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1305 7.74e-20 SMART
low complexity region 1332 1363 N/A INTRINSIC
low complexity region 1434 1449 N/A INTRINSIC
4.1m 1452 1470 1.19e-6 SMART
low complexity region 1489 1501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161102
Predicted Effect possibly damaging
Transcript: ENSMUST00000161402
AA Change: R175H

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124116
Gene: ENSMUSG00000024109
AA Change: R175H

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 453 3.46e-31 SMART
LamG 507 659 2.74e-43 SMART
EGF 686 720 1.58e-3 SMART
LamG 745 884 7.27e-25 SMART
LamG 932 1068 8.46e-35 SMART
EGF 1093 1127 1.87e1 SMART
LamG 1155 1312 7.74e-20 SMART
low complexity region 1339 1370 N/A INTRINSIC
low complexity region 1441 1456 N/A INTRINSIC
4.1m 1459 1477 1.19e-6 SMART
low complexity region 1496 1508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174331
AA Change: R175H

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133491
Gene: ENSMUSG00000024109
AA Change: R175H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1275 3.29e-23 SMART
low complexity region 1302 1333 N/A INTRINSIC
low complexity region 1404 1419 N/A INTRINSIC
4.1m 1422 1440 1.19e-6 SMART
low complexity region 1459 1471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161637
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are synaptic transmembrane receptors that bind endogenous ligands that include neuroligins, dystroglycan, and neurexophilins. Neurexin complexes are required for efficient neurotransmission and are involved in synaptogenesis. In vertebrates, alternate promoter usage results in multiple isoform classes, of which the alpha and beta classes are the best characterized. In humans, allelic variants in this gene are associated with Pitt-Hopkins-like syndrome-2, while deletions have been associated with autism and schizophrenia. Mouse knockouts display decreased spontaneous and evoked vesicle release resulting in impaired synaptic transmission. In addition, knockout mice show altered social approach, reduced social investigation, reduced locomotor activity, and in males, increased aggression. Alternative splicing and promoter usage result in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Ca(2+)-dependent binding of alpha-latrotoxin to brain membranes. Isolated synaptosomes display only a small reduction in alpha-latrotoxin -triggered glutamate release in the absence of Ca(2+) but show a major decrease in the presence of Ca(2+). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,364,029 (GRCm39) I103V possibly damaging Het
Adam3 T C 8: 25,167,383 (GRCm39) N36S probably benign Het
Adamts3 A G 5: 90,009,528 (GRCm39) V45A probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Agtpbp1 A T 13: 59,681,860 (GRCm39) L69* probably null Het
Alkbh5 T A 11: 60,429,517 (GRCm39) I90N probably damaging Het
Alx1 T C 10: 102,858,120 (GRCm39) Y193C probably damaging Het
Ankrd11 T G 8: 123,619,139 (GRCm39) D1571A probably damaging Het
Brd4 T C 17: 32,417,700 (GRCm39) D124G probably benign Het
C2cd2 G A 16: 97,676,418 (GRCm39) T443I probably benign Het
Casp8 A T 1: 58,868,071 (GRCm39) M171L probably benign Het
Cd200r4 G A 16: 44,653,295 (GRCm39) V22I probably benign Het
Cdcp2 A G 4: 106,962,478 (GRCm39) Y217C probably damaging Het
Cfh C A 1: 140,046,409 (GRCm39) V556F possibly damaging Het
Chka T G 19: 3,934,513 (GRCm39) I182M probably damaging Het
Cope T C 8: 70,755,193 (GRCm39) probably null Het
Coq10b T C 1: 55,092,077 (GRCm39) V15A probably benign Het
Cpne9 T A 6: 113,270,710 (GRCm39) S309T probably benign Het
Daam2 T A 17: 49,766,232 (GRCm39) H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 (GRCm39) probably null Het
Dhx35 G T 2: 158,684,789 (GRCm39) R536L probably benign Het
Dnah8 G T 17: 31,034,638 (GRCm39) E4186* probably null Het
Dnah9 A G 11: 65,725,307 (GRCm39) L4282P probably damaging Het
Dpp10 A G 1: 123,312,012 (GRCm39) probably null Het
Dst T A 1: 34,199,453 (GRCm39) probably benign Het
Ehbp1 C A 11: 22,101,887 (GRCm39) V214L probably benign Het
Fam131b T C 6: 42,298,905 (GRCm39) D25G probably damaging Het
Fbxl13 T A 5: 21,787,089 (GRCm39) I283F probably damaging Het
Gabrr3 T G 16: 59,254,931 (GRCm39) N205K possibly damaging Het
Got1l1 C T 8: 27,687,951 (GRCm39) probably null Het
Gprin1 G A 13: 54,887,791 (GRCm39) A161V probably benign Het
Hepacam2 A T 6: 3,476,149 (GRCm39) F183I probably damaging Het
Hmx2 A G 7: 131,156,279 (GRCm39) T82A probably benign Het
Igsf10 C T 3: 59,243,894 (GRCm39) E147K probably damaging Het
Kndc1 G A 7: 139,519,740 (GRCm39) A1700T probably benign Het
Knl1 T C 2: 118,899,841 (GRCm39) V514A possibly damaging Het
Lama2 T C 10: 27,111,728 (GRCm39) D764G probably damaging Het
Lgi3 G A 14: 70,773,900 (GRCm39) R358H probably damaging Het
Limd1 G T 9: 123,308,479 (GRCm39) Q59H possibly damaging Het
Lrrk2 A G 15: 91,657,148 (GRCm39) Y1814C possibly damaging Het
Lysmd3 G A 13: 81,813,393 (GRCm39) probably null Het
Mroh7 T C 4: 106,578,123 (GRCm39) N185S probably benign Het
Muc2 A G 7: 141,283,493 (GRCm39) probably null Het
Muc2 G A 7: 141,305,143 (GRCm39) G149D probably damaging Het
Nlrp3 T C 11: 59,439,797 (GRCm39) F458S probably benign Het
Nop58 A T 1: 59,741,990 (GRCm39) D173V probably damaging Het
Nxpe4 A G 9: 48,307,862 (GRCm39) N322S probably benign Het
Ocstamp A G 2: 165,239,467 (GRCm39) S240P probably damaging Het
Or10a5 G A 7: 106,635,543 (GRCm39) M60I probably damaging Het
Or2j3 T C 17: 38,616,083 (GRCm39) K90E probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,666 (GRCm39) H242R probably damaging Het
Ovch2 G A 7: 107,393,595 (GRCm39) T177I possibly damaging Het
Parn A C 16: 13,424,035 (GRCm39) L454R probably damaging Het
Pcdhb12 T A 18: 37,571,044 (GRCm39) L730Q possibly damaging Het
Phf3 G T 1: 30,844,827 (GRCm39) F1377L probably damaging Het
Pign G T 1: 105,516,999 (GRCm39) S542R probably benign Het
Prex2 G T 1: 11,202,596 (GRCm39) V502F probably damaging Het
Psmd1 A T 1: 86,017,775 (GRCm39) I529F possibly damaging Het
Ptafr A G 4: 132,306,616 (GRCm39) E2G probably benign Het
R3hdm1 A G 1: 128,138,960 (GRCm39) N380S probably benign Het
Rbm12 A C 2: 155,939,679 (GRCm39) probably benign Het
Rgl1 A G 1: 152,433,244 (GRCm39) Y174H probably damaging Het
Rps6kc1 A G 1: 190,532,632 (GRCm39) S457P probably damaging Het
Sall4 A T 2: 168,592,263 (GRCm39) S964T probably benign Het
Sart1 T A 19: 5,431,251 (GRCm39) I681F probably damaging Het
Serinc5 T C 13: 92,797,644 (GRCm39) L49P probably benign Het
Serpinb9e T C 13: 33,439,036 (GRCm39) V154A probably benign Het
Skic2 A T 17: 35,060,439 (GRCm39) N851K probably benign Het
Smox G A 2: 131,358,334 (GRCm39) V136I probably damaging Het
Sspo C T 6: 48,440,627 (GRCm39) T1747I probably benign Het
Swt1 A T 1: 151,283,339 (GRCm39) D339E possibly damaging Het
Synpo2 A G 3: 122,911,060 (GRCm39) L195P probably damaging Het
Syt7 G T 19: 10,420,843 (GRCm39) G414W probably damaging Het
Tmem186 G A 16: 8,454,024 (GRCm39) T79I probably damaging Het
Tmem39a A T 16: 38,396,106 (GRCm39) N113I probably damaging Het
Trim14 C T 4: 46,507,239 (GRCm39) V326M probably damaging Het
Trim58 A G 11: 58,536,909 (GRCm39) E234G probably damaging Het
Ttr T C 18: 20,803,059 (GRCm39) L75P probably damaging Het
Ubr1 C T 2: 120,776,863 (GRCm39) V293I probably benign Het
Vmn1r91 T A 7: 19,835,990 (GRCm39) V303E probably benign Het
Vmn2r30 A C 7: 7,315,334 (GRCm39) I833S probably damaging Het
Zfp131 G T 13: 120,237,982 (GRCm39) N125K probably benign Het
Zfp169 A T 13: 48,644,516 (GRCm39) probably benign Het
Zfp213 C A 17: 23,776,885 (GRCm39) E386* probably null Het
Other mutations in Nrxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Nrxn1 APN 17 90,366,902 (GRCm39) critical splice donor site probably null
IGL01644:Nrxn1 APN 17 90,928,301 (GRCm39) missense possibly damaging 0.94
IGL01820:Nrxn1 APN 17 90,950,531 (GRCm39) missense probably damaging 0.98
IGL01902:Nrxn1 APN 17 91,395,919 (GRCm39) splice site probably null
IGL02079:Nrxn1 APN 17 90,950,511 (GRCm39) missense probably damaging 0.99
IGL02089:Nrxn1 APN 17 91,395,829 (GRCm39) missense probably benign 0.01
IGL02133:Nrxn1 APN 17 90,950,671 (GRCm39) missense probably damaging 1.00
IGL02179:Nrxn1 APN 17 90,937,511 (GRCm39) missense probably damaging 0.99
IGL02199:Nrxn1 APN 17 90,344,686 (GRCm39) missense probably damaging 1.00
IGL02262:Nrxn1 APN 17 91,011,636 (GRCm39) missense probably damaging 1.00
IGL02941:Nrxn1 APN 17 90,515,811 (GRCm39) missense probably damaging 1.00
PIT4449001:Nrxn1 UTSW 17 90,905,007 (GRCm39) missense probably damaging 1.00
PIT4791001:Nrxn1 UTSW 17 90,762,931 (GRCm39) intron probably benign
R0123:Nrxn1 UTSW 17 91,302,915 (GRCm39) splice site probably null
R0212:Nrxn1 UTSW 17 90,670,186 (GRCm39) unclassified probably benign
R0277:Nrxn1 UTSW 17 91,008,170 (GRCm39) critical splice donor site probably null
R0323:Nrxn1 UTSW 17 91,008,170 (GRCm39) critical splice donor site probably null
R0384:Nrxn1 UTSW 17 90,515,775 (GRCm39) missense probably damaging 1.00
R0395:Nrxn1 UTSW 17 91,395,742 (GRCm39) missense possibly damaging 0.90
R0606:Nrxn1 UTSW 17 90,872,801 (GRCm39) missense probably damaging 1.00
R0616:Nrxn1 UTSW 17 90,670,285 (GRCm39) missense probably damaging 1.00
R0624:Nrxn1 UTSW 17 91,396,117 (GRCm39) missense unknown
R0633:Nrxn1 UTSW 17 91,011,609 (GRCm39) missense probably damaging 1.00
R0927:Nrxn1 UTSW 17 90,344,758 (GRCm39) missense probably damaging 1.00
R1035:Nrxn1 UTSW 17 90,471,302 (GRCm39) missense probably damaging 0.96
R1221:Nrxn1 UTSW 17 90,950,722 (GRCm39) missense probably damaging 0.97
R1403:Nrxn1 UTSW 17 90,950,481 (GRCm39) missense probably benign 0.11
R1403:Nrxn1 UTSW 17 90,950,481 (GRCm39) missense probably benign 0.11
R1691:Nrxn1 UTSW 17 90,469,717 (GRCm39) missense probably damaging 0.98
R1703:Nrxn1 UTSW 17 90,515,845 (GRCm39) missense probably damaging 1.00
R1709:Nrxn1 UTSW 17 90,344,615 (GRCm39) missense probably damaging 1.00
R1721:Nrxn1 UTSW 17 90,469,832 (GRCm39) missense probably damaging 1.00
R1792:Nrxn1 UTSW 17 90,896,252 (GRCm39) missense probably damaging 0.96
R1980:Nrxn1 UTSW 17 91,395,746 (GRCm39) missense probably benign 0.01
R2116:Nrxn1 UTSW 17 91,011,705 (GRCm39) missense probably damaging 1.00
R2117:Nrxn1 UTSW 17 91,011,705 (GRCm39) missense probably damaging 1.00
R2162:Nrxn1 UTSW 17 90,469,859 (GRCm39) missense probably damaging 1.00
R3119:Nrxn1 UTSW 17 90,904,947 (GRCm39) nonsense probably null
R3409:Nrxn1 UTSW 17 90,515,795 (GRCm39) missense probably damaging 1.00
R3683:Nrxn1 UTSW 17 90,930,880 (GRCm39) missense probably damaging 1.00
R3885:Nrxn1 UTSW 17 90,930,899 (GRCm39) missense probably damaging 1.00
R3939:Nrxn1 UTSW 17 90,515,849 (GRCm39) missense probably damaging 1.00
R4475:Nrxn1 UTSW 17 91,009,410 (GRCm39) missense probably damaging 0.98
R4640:Nrxn1 UTSW 17 90,868,196 (GRCm39) missense probably damaging 1.00
R4678:Nrxn1 UTSW 17 90,930,850 (GRCm39) missense probably damaging 1.00
R4690:Nrxn1 UTSW 17 90,344,509 (GRCm39) missense probably damaging 1.00
R4790:Nrxn1 UTSW 17 90,762,477 (GRCm39) missense possibly damaging 0.86
R4877:Nrxn1 UTSW 17 91,395,605 (GRCm39) missense probably benign 0.33
R4989:Nrxn1 UTSW 17 90,928,274 (GRCm39) intron probably benign
R5204:Nrxn1 UTSW 17 90,469,792 (GRCm39) missense probably damaging 1.00
R5205:Nrxn1 UTSW 17 90,471,302 (GRCm39) missense probably damaging 0.96
R5239:Nrxn1 UTSW 17 91,011,537 (GRCm39) missense probably damaging 1.00
R5250:Nrxn1 UTSW 17 90,842,869 (GRCm39) intron probably benign
R5473:Nrxn1 UTSW 17 90,897,520 (GRCm39) missense probably damaging 1.00
R5629:Nrxn1 UTSW 17 90,897,460 (GRCm39) missense possibly damaging 0.75
R5743:Nrxn1 UTSW 17 90,950,652 (GRCm39) missense probably damaging 1.00
R5910:Nrxn1 UTSW 17 91,011,746 (GRCm39) nonsense probably null
R5961:Nrxn1 UTSW 17 90,762,371 (GRCm39) missense probably damaging 0.99
R5992:Nrxn1 UTSW 17 90,930,935 (GRCm39) missense probably benign 0.01
R6024:Nrxn1 UTSW 17 90,897,526 (GRCm39) missense possibly damaging 0.88
R6031:Nrxn1 UTSW 17 90,896,218 (GRCm39) missense probably damaging 1.00
R6031:Nrxn1 UTSW 17 90,896,218 (GRCm39) missense probably damaging 1.00
R6185:Nrxn1 UTSW 17 90,344,564 (GRCm39) missense probably damaging 1.00
R6220:Nrxn1 UTSW 17 91,395,904 (GRCm39) missense probably benign 0.14
R6306:Nrxn1 UTSW 17 90,872,874 (GRCm39) missense possibly damaging 0.55
R6621:Nrxn1 UTSW 17 90,469,610 (GRCm39) missense probably damaging 1.00
R6669:Nrxn1 UTSW 17 90,366,991 (GRCm39) missense probably damaging 0.98
R6770:Nrxn1 UTSW 17 90,344,607 (GRCm39) missense probably damaging 1.00
R6798:Nrxn1 UTSW 17 90,937,378 (GRCm39) missense probably damaging 1.00
R6923:Nrxn1 UTSW 17 91,395,661 (GRCm39) missense probably benign 0.06
R7140:Nrxn1 UTSW 17 91,396,192 (GRCm39) start gained probably benign
R7374:Nrxn1 UTSW 17 90,896,097 (GRCm39) critical splice donor site probably null
R7564:Nrxn1 UTSW 17 90,670,334 (GRCm39) missense possibly damaging 0.64
R7570:Nrxn1 UTSW 17 90,469,807 (GRCm39) missense probably benign 0.35
R7800:Nrxn1 UTSW 17 91,396,635 (GRCm39) unclassified probably benign
R7828:Nrxn1 UTSW 17 90,366,979 (GRCm39) missense probably damaging 0.99
R7974:Nrxn1 UTSW 17 91,008,207 (GRCm39) missense probably damaging 1.00
R8001:Nrxn1 UTSW 17 91,395,964 (GRCm39) missense possibly damaging 0.49
R8189:Nrxn1 UTSW 17 91,011,637 (GRCm39) missense probably damaging 0.96
R8258:Nrxn1 UTSW 17 90,471,249 (GRCm39) missense probably damaging 0.99
R8259:Nrxn1 UTSW 17 90,471,249 (GRCm39) missense probably damaging 0.99
R8298:Nrxn1 UTSW 17 91,011,597 (GRCm39) missense probably damaging 1.00
R8801:Nrxn1 UTSW 17 91,009,393 (GRCm39) critical splice donor site probably benign
R8814:Nrxn1 UTSW 17 90,937,529 (GRCm39) missense probably damaging 1.00
R8873:Nrxn1 UTSW 17 90,872,821 (GRCm39) nonsense probably null
R8954:Nrxn1 UTSW 17 90,897,615 (GRCm39) missense probably damaging 1.00
R9086:Nrxn1 UTSW 17 90,469,792 (GRCm39) missense probably damaging 1.00
R9110:Nrxn1 UTSW 17 90,869,233 (GRCm39) nonsense probably null
R9498:Nrxn1 UTSW 17 90,897,397 (GRCm39) missense probably damaging 1.00
R9499:Nrxn1 UTSW 17 90,937,450 (GRCm39) missense probably damaging 1.00
R9552:Nrxn1 UTSW 17 90,937,450 (GRCm39) missense probably damaging 1.00
R9780:Nrxn1 UTSW 17 90,931,042 (GRCm39) missense possibly damaging 0.54
RF005:Nrxn1 UTSW 17 90,670,304 (GRCm39) missense probably damaging 1.00
RF024:Nrxn1 UTSW 17 90,670,304 (GRCm39) missense probably damaging 1.00
X0021:Nrxn1 UTSW 17 90,897,640 (GRCm39) missense probably damaging 1.00
X0063:Nrxn1 UTSW 17 90,670,259 (GRCm39) missense possibly damaging 0.54
Z1088:Nrxn1 UTSW 17 90,366,933 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTTGGCTGCAGTCCTTG -3'
(R):5'- TCGTGCTCTACTTCGACGAC -3'

Sequencing Primer
(F):5'- TCCTCGAGCAGTCGCATAC -3'
(R):5'- ACGAGGGCTTCTGCGACTTC -3'
Posted On 2017-06-26