Incidental Mutation 'R5979:Pcdhb12'
ID481351
Institutional Source Beutler Lab
Gene Symbol Pcdhb12
Ensembl Gene ENSMUSG00000043458
Gene Nameprotocadherin beta 12
SynonymsPcdh3, PcdhbL, Pcdhb5F
MMRRC Submission 044161-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5979 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37435621-37438654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37437991 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 730 (L730Q)
Ref Sequence ENSEMBL: ENSMUSP00000050357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055495] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055495
AA Change: L730Q

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050357
Gene: ENSMUSG00000043458
AA Change: L730Q

DomainStartEndE-ValueType
CA 53 130 1.67e-1 SMART
CA 154 239 3.69e-23 SMART
CA 263 343 6.56e-29 SMART
CA 366 447 5.9e-22 SMART
CA 471 557 4.24e-23 SMART
CA 587 668 1.01e-11 SMART
Pfam:Cadherin_C_2 685 768 4.8e-26 PFAM
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193629
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Pcdhb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pcdhb12 APN 18 37436982 missense probably benign 0.44
IGL01309:Pcdhb12 APN 18 37436154 missense probably damaging 1.00
IGL01834:Pcdhb12 APN 18 37437639 missense probably damaging 1.00
IGL01893:Pcdhb12 APN 18 37437210 missense probably benign 0.01
IGL02617:Pcdhb12 APN 18 37437046 missense probably benign 0.43
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0309:Pcdhb12 UTSW 18 37436121 missense probably benign
R0392:Pcdhb12 UTSW 18 37436958 missense possibly damaging 0.60
R0494:Pcdhb12 UTSW 18 37438095 missense probably benign
R0531:Pcdhb12 UTSW 18 37437318 missense probably damaging 1.00
R0571:Pcdhb12 UTSW 18 37437208 missense probably damaging 1.00
R0737:Pcdhb12 UTSW 18 37437709 missense probably damaging 1.00
R0882:Pcdhb12 UTSW 18 37437322 missense probably damaging 1.00
R1253:Pcdhb12 UTSW 18 37435821 missense possibly damaging 0.65
R1300:Pcdhb12 UTSW 18 37437397 missense possibly damaging 0.45
R1334:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1424:Pcdhb12 UTSW 18 37438079 missense probably benign
R1513:Pcdhb12 UTSW 18 37437058 missense probably damaging 1.00
R1654:Pcdhb12 UTSW 18 37436701 missense probably damaging 1.00
R1717:Pcdhb12 UTSW 18 37436788 missense probably damaging 1.00
R1753:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1774:Pcdhb12 UTSW 18 37436442 missense possibly damaging 0.52
R1893:Pcdhb12 UTSW 18 37437083 missense probably benign 0.24
R1901:Pcdhb12 UTSW 18 37437630 missense possibly damaging 0.67
R2114:Pcdhb12 UTSW 18 37436212 missense probably damaging 1.00
R2264:Pcdhb12 UTSW 18 37436805 missense probably damaging 0.99
R2915:Pcdhb12 UTSW 18 37437640 missense probably damaging 1.00
R3689:Pcdhb12 UTSW 18 37436074 missense probably benign 0.01
R3918:Pcdhb12 UTSW 18 37437048 missense probably benign
R4621:Pcdhb12 UTSW 18 37437160 missense probably benign
R4679:Pcdhb12 UTSW 18 37436949 missense probably damaging 1.00
R4709:Pcdhb12 UTSW 18 37437495 missense probably benign 0.08
R4904:Pcdhb12 UTSW 18 37437856 missense possibly damaging 0.80
R4953:Pcdhb12 UTSW 18 37436156 missense probably damaging 1.00
R5091:Pcdhb12 UTSW 18 37435854 nonsense probably null
R5130:Pcdhb12 UTSW 18 37435824 missense probably benign
R5204:Pcdhb12 UTSW 18 37436089 missense probably damaging 0.99
R5361:Pcdhb12 UTSW 18 37437046 missense probably damaging 1.00
R5417:Pcdhb12 UTSW 18 37436034 missense probably benign 0.00
R6117:Pcdhb12 UTSW 18 37435642 intron probably benign
R6258:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6260:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6270:Pcdhb12 UTSW 18 37436785 missense possibly damaging 0.68
R6623:Pcdhb12 UTSW 18 37437658 missense possibly damaging 0.54
R7288:Pcdhb12 UTSW 18 37436015 missense probably benign 0.07
R7733:Pcdhb12 UTSW 18 37437036 missense probably damaging 1.00
R7762:Pcdhb12 UTSW 18 37435924 missense probably damaging 0.98
R8131:Pcdhb12 UTSW 18 37437282 missense possibly damaging 0.91
R8331:Pcdhb12 UTSW 18 37437289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACGATTATGACGTGCTCAC -3'
(R):5'- GTTGACTCATGGCACTATACAATTG -3'

Sequencing Primer
(F):5'- GTGCTCACGCTGTACCTAG -3'
(R):5'- GGAAAAATGAGGTCACCACTTC -3'
Posted On2017-06-26