Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Afg3l2'

481352

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

044161-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5979 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67421259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 458 (L458M)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Meta Mutation Damage Score

0.3865

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Sart1	T	A	19: 5,381,223	I681F	probably damaging	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GCACTGTCCAGCTTCAATGG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'

Posted On

2017-06-26