Mutagenetix > Incidental Mutation

Incidental Mutation 'R5979:Sart1'

481354

Institutional Source

Beutler Lab

Gene Symbol

Sart1

Ensembl Gene

ENSMUSG00000039148

Gene Name

squamous cell carcinoma antigen recognized by T cells 1

Synonyms

U5-110K

MMRRC Submission

044161-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5979 (G1)

Quality Score

142.008

Status

Validated

Chromosome

Chromosomal Location

5377523-5388703 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 5381223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 681 (I681F)

Ref Sequence

ENSEMBL: ENSMUSP00000047397 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044207]

AlphaFold

Q9Z315

Predicted Effect

probably damaging
Transcript: ENSMUST00000044207
AA Change: I681F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047397
Gene: ENSMUSG00000039148
AA Change: I681F

Domain	Start	End	E-Value	Type
low complexity region	13	26	N/A	INTRINSIC
low complexity region	31	83	N/A	INTRINSIC
Pfam:SART-1	117	759	1.5e-151	PFAM

Meta Mutation Damage Score

0.6758

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.4%

Validation Efficiency

100% (87/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins, the SART1(800) protein expressed in the nucleus of the majority of proliferating cells, and the SART1(259) protein expressed in the cytosol of epithelial cancers. The SART1(259) protein is translated by the mechanism of -1 frameshifting during posttranscriptional regulation; its full-length sequence is not published yet. The two encoded proteins are thought to be involved in the regulation of proliferation. Both proteins have tumor-rejection antigens. The SART1(259) protein possesses tumor epitopes capable of inducing HLA-A2402-restricted cytotoxic T lymphocytes in cancer patients. This SART1(259) antigen may be useful in specific immunotherapy for cancer patients and may serve as a paradigmatic tool for the diagnosis and treatment of patients with atopy. The SART1(259) protein is found to be essential for the recruitment of the tri-snRNP to the pre-spliceosome in the spliceosome assembly pathway. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	A	G	2: 155,522,109	I103V	possibly damaging	Het
Adam3	T	C	8: 24,677,367	N36S	probably benign	Het
Adamts3	A	G	5: 89,861,669	V45A	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Agtpbp1	A	T	13: 59,534,046	L69*	probably null	Het
Alkbh5	T	A	11: 60,538,691	I90N	probably damaging	Het
Alx1	T	C	10: 103,022,259	Y193C	probably damaging	Het
Ankrd11	T	G	8: 122,892,400	D1571A	probably damaging	Het
Brd4	T	C	17: 32,198,726	D124G	probably benign	Het
C2cd2	G	A	16: 97,875,218	T443I	probably benign	Het
Casp8	A	T	1: 58,828,912	M171L	probably benign	Het
Cd200r4	G	A	16: 44,832,932	V22I	probably benign	Het
Cdcp2	A	G	4: 107,105,281	Y217C	probably damaging	Het
Cfh	C	A	1: 140,118,671	V556F	possibly damaging	Het
Chka	T	G	19: 3,884,513	I182M	probably damaging	Het
Cope	T	C	8: 70,302,543		probably null	Het
Coq10b	T	C	1: 55,052,918	V15A	probably benign	Het
Cpne9	T	A	6: 113,293,749	S309T	probably benign	Het
Daam2	T	A	17: 49,459,204	H992L	possibly damaging	Het
Dctn3	T	C	4: 41,715,393		probably null	Het
Dhx35	G	T	2: 158,842,869	R536L	probably benign	Het
Dnah8	G	T	17: 30,815,664	E4186*	probably null	Het
Dnah9	A	G	11: 65,834,481	L4282P	probably damaging	Het
Dpp10	A	G	1: 123,384,283		probably null	Het
Dst	T	A	1: 34,160,372		probably benign	Het
Ehbp1	C	A	11: 22,151,887	V214L	probably benign	Het
Fam131b	T	C	6: 42,321,971	D25G	probably damaging	Het
Fbxl13	T	A	5: 21,582,091	I283F	probably damaging	Het
Gabrr3	T	G	16: 59,434,568	N205K	possibly damaging	Het
Got1l1	C	T	8: 27,197,923		probably null	Het
Gprin1	G	A	13: 54,739,978	A161V	probably benign	Het
Hepacam2	A	T	6: 3,476,149	F183I	probably damaging	Het
Hmx2	A	G	7: 131,554,550	T82A	probably benign	Het
Igsf10	C	T	3: 59,336,473	E147K	probably damaging	Het
Kndc1	G	A	7: 139,939,827	A1700T	probably benign	Het
Knl1	T	C	2: 119,069,360	V514A	possibly damaging	Het
Lama2	T	C	10: 27,235,732	D764G	probably damaging	Het
Lgi3	G	A	14: 70,536,460	R358H	probably damaging	Het
Limd1	G	T	9: 123,479,414	Q59H	possibly damaging	Het
Lrrk2	A	G	15: 91,772,945	Y1814C	possibly damaging	Het
Lysmd3	G	A	13: 81,665,274		probably null	Het
Mroh7	T	C	4: 106,720,926	N185S	probably benign	Het
Muc2	A	G	7: 141,697,250		probably null	Het
Muc2	G	A	7: 141,751,406	G149D	probably damaging	Het
Nlrp3	T	C	11: 59,548,971	F458S	probably benign	Het
Nop58	A	T	1: 59,702,831	D173V	probably damaging	Het
Nrxn1	C	T	17: 91,088,203	R175H	possibly damaging	Het
Nxpe4	A	G	9: 48,396,562	N322S	probably benign	Het
Ocstamp	A	G	2: 165,397,547	S240P	probably damaging	Het
Olfr137	T	C	17: 38,305,192	K90E	probably benign	Het
Olfr311	A	G	11: 58,841,840	H242R	probably damaging	Het
Olfr713	G	A	7: 107,036,336	M60I	probably damaging	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Ovch2	G	A	7: 107,794,388	T177I	possibly damaging	Het
Parn	A	C	16: 13,606,171	L454R	probably damaging	Het
Pcdhb12	T	A	18: 37,437,991	L730Q	possibly damaging	Het
Phf3	G	T	1: 30,805,746	F1377L	probably damaging	Het
Pign	G	T	1: 105,589,274	S542R	probably benign	Het
Prex2	G	T	1: 11,132,372	V502F	probably damaging	Het
Psmd1	A	T	1: 86,090,053	I529F	possibly damaging	Het
Ptafr	A	G	4: 132,579,305	E2G	probably benign	Het
R3hdm1	A	G	1: 128,211,223	N380S	probably benign	Het
Rbm12	A	C	2: 156,097,759		probably benign	Het
Rgl1	A	G	1: 152,557,493	Y174H	probably damaging	Het
Rps6kc1	A	G	1: 190,800,435	S457P	probably damaging	Het
Sall4	A	T	2: 168,750,343	S964T	probably benign	Het
Serinc5	T	C	13: 92,661,136	L49P	probably benign	Het
Serpinb9e	T	C	13: 33,255,053	V154A	probably benign	Het
Skiv2l	A	T	17: 34,841,463	N851K	probably benign	Het
Smox	G	A	2: 131,516,414	V136I	probably damaging	Het
Sspo	C	T	6: 48,463,693	T1747I	probably benign	Het
Swt1	A	T	1: 151,407,588	D339E	possibly damaging	Het
Synpo2	A	G	3: 123,117,411	L195P	probably damaging	Het
Syt7	G	T	19: 10,443,479	G414W	probably damaging	Het
Tmem186	G	A	16: 8,636,160	T79I	probably damaging	Het
Tmem39a	A	T	16: 38,575,744	N113I	probably damaging	Het
Trim14	C	T	4: 46,507,239	V326M	probably damaging	Het
Trim58	A	G	11: 58,646,083	E234G	probably damaging	Het
Ttr	T	C	18: 20,670,002	L75P	probably damaging	Het
Ubr1	C	T	2: 120,946,382	V293I	probably benign	Het
Vmn1r91	T	A	7: 20,102,065	V303E	probably benign	Het
Vmn2r30	A	C	7: 7,312,335	I833S	probably damaging	Het
Zfp131	G	T	13: 119,776,446	N125K	probably benign	Het
Zfp169	A	T	13: 48,491,040		probably benign	Het
Zfp213	C	A	17: 23,557,911	E386*	probably null	Het

Other mutations in Sart1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Sart1	APN	19	5383951	missense	probably benign	0.00
IGL02390:Sart1	APN	19	5380461	missense	possibly damaging	0.85
IGL02533:Sart1	APN	19	5383721	nonsense	probably null
IGL03094:Sart1	APN	19	5384081	splice site	probably benign
R0219:Sart1	UTSW	19	5388396	missense	probably benign
R0226:Sart1	UTSW	19	5381122	splice site	probably benign
R0304:Sart1	UTSW	19	5380531	splice site	probably benign
R0537:Sart1	UTSW	19	5381724	missense	probably damaging	0.99
R0668:Sart1	UTSW	19	5384256	missense	probably damaging	1.00
R1574:Sart1	UTSW	19	5380259	missense	probably damaging	1.00
R1574:Sart1	UTSW	19	5380259	missense	probably damaging	1.00
R1674:Sart1	UTSW	19	5385825	missense	probably damaging	0.99
R4077:Sart1	UTSW	19	5382743	missense	possibly damaging	0.48
R4866:Sart1	UTSW	19	5382220	missense	probably damaging	1.00
R5081:Sart1	UTSW	19	5388548	missense	possibly damaging	0.72
R5523:Sart1	UTSW	19	5383676	missense	probably damaging	0.99
R5756:Sart1	UTSW	19	5380469	missense	probably damaging	1.00
R5875:Sart1	UTSW	19	5383795	missense	probably damaging	1.00
R7360:Sart1	UTSW	19	5383203	missense	probably damaging	0.96
R7560:Sart1	UTSW	19	5384877	missense	probably damaging	0.97
R7764:Sart1	UTSW	19	5388585	missense	probably damaging	1.00
R8426:Sart1	UTSW	19	5383741	missense	probably benign
R8517:Sart1	UTSW	19	5383197	missense	probably damaging	0.98
R8796:Sart1	UTSW	19	5388348	missense	probably damaging	1.00
R8927:Sart1	UTSW	19	5388501	missense	probably benign
R8928:Sart1	UTSW	19	5388501	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGAAGTCCTGGGTGAAGC -3'
(R):5'- GTGGGCTAAACCGGATACAC -3'

Sequencing Primer
(F):5'- GGTGAAGCCCCTGTACTCCTC -3'
(R):5'- CCTCCTTAGGGAAGTGCTGATC -3'

Posted On

2017-06-26