Incidental Mutation 'R5979:Syt7'
ID481355
Institutional Source Beutler Lab
Gene Symbol Syt7
Ensembl Gene ENSMUSG00000024743
Gene Namesynaptotagmin VII
Synonyms
MMRRC Submission 044161-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5979 (G1)
Quality Score185.009
Status Validated
Chromosome19
Chromosomal Location10389090-10453181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10443479 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 414 (G414W)
Ref Sequence ENSEMBL: ENSMUSP00000153132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073899] [ENSMUST00000076968] [ENSMUST00000169121] [ENSMUST00000223586] [ENSMUST00000224135]
Predicted Effect probably damaging
Transcript: ENSMUST00000073899
AA Change: G299W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073560
Gene: ENSMUSG00000024743
AA Change: G299W

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 151 254 3.29e-25 SMART
low complexity region 261 274 N/A INTRINSIC
C2 282 396 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076968
AA Change: G507W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076234
Gene: ENSMUSG00000024743
AA Change: G507W

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 195 298 3.29e-25 SMART
low complexity region 305 318 N/A INTRINSIC
C2 326 440 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169121
AA Change: G463W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127973
Gene: ENSMUSG00000024743
AA Change: G463W

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
low complexity region 104 121 N/A INTRINSIC
C2 315 418 3.29e-25 SMART
low complexity region 425 438 N/A INTRINSIC
C2 446 560 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223586
AA Change: G343W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224135
AA Change: G414W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225861
Meta Mutation Damage Score 0.3026 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have no gross abnormalities or obvious neurological defects. They do develop fibrosis in the skin and skeletal muscle over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lama2 T C 10: 27,235,732 D764G probably damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Syt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Syt7 APN 19 10443391 missense probably benign 0.03
R0412:Syt7 UTSW 19 10444080 nonsense probably null
R1068:Syt7 UTSW 19 10444011 missense probably benign 0.01
R1793:Syt7 UTSW 19 10443990 missense probably damaging 1.00
R1955:Syt7 UTSW 19 10418038 missense probably damaging 1.00
R2049:Syt7 UTSW 19 10439213 missense probably benign 0.28
R2170:Syt7 UTSW 19 10439380 missense probably damaging 1.00
R2911:Syt7 UTSW 19 10443435 missense probably benign 0.00
R3694:Syt7 UTSW 19 10435636 missense possibly damaging 0.69
R4330:Syt7 UTSW 19 10421798 missense probably damaging 1.00
R4573:Syt7 UTSW 19 10439212 nonsense probably null
R4691:Syt7 UTSW 19 10426481 missense probably damaging 0.98
R4732:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4733:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4811:Syt7 UTSW 19 10435567 missense probably damaging 0.98
R5067:Syt7 UTSW 19 10442858 missense possibly damaging 0.58
R5069:Syt7 UTSW 19 10439237 missense probably benign 0.00
R5071:Syt7 UTSW 19 10443428 missense possibly damaging 0.92
R5372:Syt7 UTSW 19 10426621 missense probably damaging 1.00
R5830:Syt7 UTSW 19 10421787 missense probably damaging 1.00
R6737:Syt7 UTSW 19 10444044 missense probably damaging 1.00
R6833:Syt7 UTSW 19 10444144 missense probably damaging 1.00
R6843:Syt7 UTSW 19 10421771 missense probably damaging 1.00
R7010:Syt7 UTSW 19 10417990 missense probably benign 0.16
R7078:Syt7 UTSW 19 10435599 missense probably benign 0.14
R7206:Syt7 UTSW 19 10417973 missense probably damaging 1.00
Z1176:Syt7 UTSW 19 10443410 missense probably damaging 1.00
Z1177:Syt7 UTSW 19 10426493 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAACTAGGCTCTCTGACCAC -3'
(R):5'- CCCAGAATATGTCCAGAGAGC -3'

Sequencing Primer
(F):5'- ACACCTGTCATCCCTGCAGG -3'
(R):5'- AGAGCTCTGCTATCTCTAGTCAGAG -3'
Posted On2017-06-26