Incidental Mutation 'R5980:Syt14'
ID481358
Institutional Source Beutler Lab
Gene Symbol Syt14
Ensembl Gene ENSMUSG00000016200
Gene Namesynaptotagmin XIV
SynonymsB230320I09Rik
MMRRC Submission 044162-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5980 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location192891233-193035775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 192980408 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 127 (Q127R)
Ref Sequence ENSEMBL: ENSMUSP00000142190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016344] [ENSMUST00000195354] [ENSMUST00000195530] [ENSMUST00000215093]
Predicted Effect probably benign
Transcript: ENSMUST00000016344
AA Change: Q127R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000016344
Gene: ENSMUSG00000016200
AA Change: Q127R

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191907
Predicted Effect possibly damaging
Transcript: ENSMUST00000195354
AA Change: Q127R

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142190
Gene: ENSMUSG00000016200
AA Change: Q127R

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
C2 276 378 1.41e0 SMART
C2 431 547 1.38e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195530
SMART Domains Protein: ENSMUSP00000141563
Gene: ENSMUSG00000016200

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215093
AA Change: Q410R

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the synaptotagmin family. The encoded protein may be involved in membrane trafficking. Disruption of a similar gene in human has been associated with autosomal recessive spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 N508D possibly damaging Het
Ago1 C T 4: 126,460,569 probably benign Het
Apol6 A T 15: 77,051,019 T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 T33A probably benign Het
Atg7 C A 6: 114,680,236 F132L possibly damaging Het
Cep104 C A 4: 153,988,473 A396E probably benign Het
Cers4 T A 8: 4,518,269 C107* probably null Het
Cntn6 T C 6: 104,848,132 S878P probably damaging Het
Dnah6 T C 6: 73,181,722 K633E probably benign Het
Dst T A 1: 34,182,891 I2592K probably benign Het
Ep400 G A 5: 110,733,729 probably benign Het
Fbn1 A G 2: 125,315,404 C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 D51A probably damaging Het
Gpi1 A G 7: 34,228,926 probably null Het
Gse1 T G 8: 120,229,637 probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 V5A probably benign Het
Irgq G A 7: 24,533,345 G204S probably damaging Het
Kansl1 T C 11: 104,343,637 K681R possibly damaging Het
Kcnv1 C A 15: 45,109,414 V358L probably damaging Het
Lrp2 A T 2: 69,535,005 S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 D155V probably damaging Het
Magel2 A T 7: 62,380,596 I1083F unknown Het
Mta3 T A 17: 83,708,405 V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 I423T probably damaging Het
Mup11 A G 4: 60,660,888 Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 V91I probably benign Het
Ngly1 A C 14: 16,270,509 Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 Q52L probably damaging Het
Nrcam T C 12: 44,571,633 V808A probably damaging Het
Olfr1058 A T 2: 86,385,797 L207* probably null Het
Olfr9 A G 10: 128,990,440 H176R probably damaging Het
Olfr993 A T 2: 85,414,165 F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 D869E probably benign Het
Pom121l2 T C 13: 21,983,376 S606P probably damaging Het
Prdm15 G A 16: 97,812,570 R517* probably null Het
Ralgapa1 T A 12: 55,770,616 probably null Het
Saraf T A 8: 34,165,387 F207I probably benign Het
Sema6d A G 2: 124,664,708 D874G probably damaging Het
Sfrp5 A T 19: 42,201,972 L14M unknown Het
Sidt1 A T 16: 44,263,312 C485* probably null Het
Sptbn4 A G 7: 27,372,171 Y1618H probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Ticrr G A 7: 79,660,955 A206T probably damaging Het
Tmem132d T A 5: 127,784,598 I820F probably benign Het
Trafd1 A G 5: 121,373,457 Y433H probably damaging Het
Trim68 A G 7: 102,678,831 V305A probably damaging Het
Vmn2r58 T A 7: 41,865,056 Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 I457V probably benign Het
Other mutations in Syt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Syt14 APN 1 192930484 missense possibly damaging 0.88
IGL01535:Syt14 APN 1 192986765 missense probably damaging 1.00
IGL01935:Syt14 APN 1 192933371 missense probably damaging 0.99
IGL02531:Syt14 APN 1 192901934 makesense probably null
IGL02716:Syt14 APN 1 192980535 missense possibly damaging 0.92
IGL03051:Syt14 APN 1 192933220 missense probably benign 0.19
IGL03268:Syt14 APN 1 192986834 missense probably benign 0.25
crumpled UTSW 1 192901869 missense possibly damaging 0.82
R0542:Syt14 UTSW 1 192930803 missense probably damaging 1.00
R0598:Syt14 UTSW 1 192897314 missense probably damaging 1.00
R1533:Syt14 UTSW 1 192930776 missense possibly damaging 0.94
R1675:Syt14 UTSW 1 192897482 missense probably damaging 1.00
R1907:Syt14 UTSW 1 192901835 missense probably damaging 1.00
R3032:Syt14 UTSW 1 192986751 missense possibly damaging 0.86
R3828:Syt14 UTSW 1 192901775 missense probably damaging 1.00
R3965:Syt14 UTSW 1 192901867 missense probably benign 0.04
R4646:Syt14 UTSW 1 192933325 missense probably damaging 1.00
R4730:Syt14 UTSW 1 192930786 missense probably damaging 1.00
R4909:Syt14 UTSW 1 192898859 missense probably damaging 1.00
R4970:Syt14 UTSW 1 192930977 intron probably benign
R5039:Syt14 UTSW 1 193026984 missense probably damaging 1.00
R5363:Syt14 UTSW 1 192930663 missense possibly damaging 0.94
R5593:Syt14 UTSW 1 192930923 missense probably damaging 1.00
R6014:Syt14 UTSW 1 192930695 missense probably damaging 0.99
R6221:Syt14 UTSW 1 192930600 missense probably damaging 1.00
R6547:Syt14 UTSW 1 192901869 missense possibly damaging 0.82
R6804:Syt14 UTSW 1 192901853 missense probably damaging 1.00
R7038:Syt14 UTSW 1 192983658 intron probably benign
R7179:Syt14 UTSW 1 192933263 missense probably damaging 1.00
R7196:Syt14 UTSW 1 193035628 missense probably benign 0.01
R7311:Syt14 UTSW 1 192980550 missense probably benign
R7577:Syt14 UTSW 1 192983577 missense unknown
R7769:Syt14 UTSW 1 192984324 missense unknown
R7779:Syt14 UTSW 1 192984443 missense unknown
R8213:Syt14 UTSW 1 192986829 missense probably benign 0.00
R8888:Syt14 UTSW 1 192897558 missense probably damaging 1.00
R8939:Syt14 UTSW 1 192930588 missense probably damaging 1.00
R8960:Syt14 UTSW 1 192984207 intron probably benign
Z1176:Syt14 UTSW 1 192933198 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAGCTGATCACAAGCTC -3'
(R):5'- CCCTGTGTGTATGTGTGCAC -3'

Sequencing Primer
(F):5'- GCTCAAACTTTTTATTTGGACTGCAC -3'
(R):5'- GTGCACACACACATTTTCATTTGTG -3'
Posted On2017-06-26