Incidental Mutation 'R5980:Ago1'
ID 481368
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission 044162-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.811) question?
Stock # R5980 (G1)
Quality Score 205.009
Status Validated
Chromosome 4
Chromosomal Location 126435012-126468583 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 126460569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably benign
Transcript: ENSMUST00000097888
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000127800
AA Change: A99T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149425
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 N508D possibly damaging Het
Apol6 A T 15: 77,051,019 T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 T33A probably benign Het
Atg7 C A 6: 114,680,236 F132L possibly damaging Het
Cep104 C A 4: 153,988,473 A396E probably benign Het
Cers4 T A 8: 4,518,269 C107* probably null Het
Cntn6 T C 6: 104,848,132 S878P probably damaging Het
Dnah6 T C 6: 73,181,722 K633E probably benign Het
Dst T A 1: 34,182,891 I2592K probably benign Het
Ep400 G A 5: 110,733,729 probably benign Het
Fbn1 A G 2: 125,315,404 C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 D51A probably damaging Het
Gpi1 A G 7: 34,228,926 probably null Het
Gse1 T G 8: 120,229,637 probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 V5A probably benign Het
Irgq G A 7: 24,533,345 G204S probably damaging Het
Kansl1 T C 11: 104,343,637 K681R possibly damaging Het
Kcnv1 C A 15: 45,109,414 V358L probably damaging Het
Lrp2 A T 2: 69,535,005 S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 D155V probably damaging Het
Magel2 A T 7: 62,380,596 I1083F unknown Het
Mta3 T A 17: 83,708,405 V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 I423T probably damaging Het
Mup11 A G 4: 60,660,888 Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 V91I probably benign Het
Ngly1 A C 14: 16,270,509 Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 Q52L probably damaging Het
Nrcam T C 12: 44,571,633 V808A probably damaging Het
Olfr1058 A T 2: 86,385,797 L207* probably null Het
Olfr9 A G 10: 128,990,440 H176R probably damaging Het
Olfr993 A T 2: 85,414,165 F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 D869E probably benign Het
Pom121l2 T C 13: 21,983,376 S606P probably damaging Het
Prdm15 G A 16: 97,812,570 R517* probably null Het
Ralgapa1 T A 12: 55,770,616 probably null Het
Saraf T A 8: 34,165,387 F207I probably benign Het
Sema6d A G 2: 124,664,708 D874G probably damaging Het
Sfrp5 A T 19: 42,201,972 L14M unknown Het
Sidt1 A T 16: 44,263,312 C485* probably null Het
Sptbn4 A G 7: 27,372,171 Y1618H probably damaging Het
Syt14 T C 1: 192,980,408 Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Ticrr G A 7: 79,660,955 A206T probably damaging Het
Tmem132d T A 5: 127,784,598 I820F probably benign Het
Trafd1 A G 5: 121,373,457 Y433H probably damaging Het
Trim68 A G 7: 102,678,831 V305A probably damaging Het
Vmn2r58 T A 7: 41,865,056 Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 I457V probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2051:Ago1 UTSW 4 126460453 missense probably benign 0.01
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 splice site probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
R7575:Ago1 UTSW 4 126453908 missense probably benign 0.12
R7625:Ago1 UTSW 4 126443229 missense probably benign 0.18
R7988:Ago1 UTSW 4 126460417 missense probably damaging 1.00
R8041:Ago1 UTSW 4 126441936 missense probably damaging 1.00
R8073:Ago1 UTSW 4 126443226 missense probably benign 0.04
R8086:Ago1 UTSW 4 126460981 missense probably benign
R8127:Ago1 UTSW 4 126454421 missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126460523 unclassified probably benign
R8878:Ago1 UTSW 4 126463723 missense probably benign 0.35
R8989:Ago1 UTSW 4 126463790 missense probably benign 0.01
R9140:Ago1 UTSW 4 126443184 missense probably benign
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126453656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCTTCCACATGGCAGGG -3'
(R):5'- CTACCATGCATGTGTCAGGC -3'

Sequencing Primer
(F):5'- GCGCACAGACTGGTGAAAGC -3'
(R):5'- CATACTTAGATGGTTAGACCCCTGG -3'
Posted On 2017-06-26