Mutagenetix > Incidental Mutation

Incidental Mutation 'R5980:Cep104'

481369

Institutional Source

Beutler Lab

Gene Symbol

Cep104

Ensembl Gene

ENSMUSG00000039523

Gene Name

centrosomal protein 104

Synonyms

MMRRC Submission

044162-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.386) question?

Stock #

R5980 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153975194-154008732 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 153988473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 396 (A396E)

Ref Sequence

ENSEMBL: ENSMUSP00000040762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047497]

AlphaFold

Q80V31

Predicted Effect

probably benign
Transcript: ENSMUST00000047497
AA Change: A396E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523
AA Change: A396E

Domain	Start	End	E-Value	Type
coiled coil region	222	249	N/A	INTRINSIC
low complexity region	288	301	N/A	INTRINSIC
low complexity region	307	320	N/A	INTRINSIC
SCOP:d1gw5b_	523	646	3e-5	SMART
coiled coil region	688	730	N/A	INTRINSIC
low complexity region	889	903	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155414

Predicted Effect

unknown
Transcript: ENSMUST00000183790
AA Change: A2E

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	C	6: 128,567,055	N508D	possibly damaging	Het
Ago1	C	T	4: 126,460,569		probably benign	Het
Apol6	A	T	15: 77,051,019	T163S	possibly damaging	Het
Arhgap27	T	C	11: 103,356,269	T33A	probably benign	Het
Atg7	C	A	6: 114,680,236	F132L	possibly damaging	Het
Cers4	T	A	8: 4,518,269	C107*	probably null	Het
Cntn6	T	C	6: 104,848,132	S878P	probably damaging	Het
Dnah6	T	C	6: 73,181,722	K633E	probably benign	Het
Dst	T	A	1: 34,182,891	I2592K	probably benign	Het
Ep400	G	A	5: 110,733,729		probably benign	Het
Fbn1	A	G	2: 125,315,404	C2320R	probably damaging	Het
Gm17677	A	C	9: 35,741,615	D51A	probably damaging	Het
Gpi1	A	G	7: 34,228,926		probably null	Het
Gse1	T	G	8: 120,229,637		probably benign	Het
Hid1	G	A	11: 115,350,948	T612I	possibly damaging	Het
Ighmbp2	G	T	19: 3,265,295	H708Q	probably benign	Het
Igkv10-95	T	C	6: 68,680,589	S10P	probably damaging	Het
Igkv14-100	T	C	6: 68,519,025	V5A	probably benign	Het
Irgq	G	A	7: 24,533,345	G204S	probably damaging	Het
Kansl1	T	C	11: 104,343,637	K681R	possibly damaging	Het
Kcnv1	C	A	15: 45,109,414	V358L	probably damaging	Het
Lrp2	A	T	2: 69,535,005	S275T	probably damaging	Het
Lysmd1	A	T	3: 95,137,908	D155V	probably damaging	Het
Magel2	A	T	7: 62,380,596	I1083F	unknown	Het
Mta3	T	A	17: 83,708,405	V12D	probably damaging	Het
Mtmr4	T	C	11: 87,604,151	I423T	probably damaging	Het
Mup11	A	G	4: 60,660,888	Y16H	possibly damaging	Het
Mycbp	G	A	4: 123,911,096	V91I	probably benign	Het
Ngly1	A	C	14: 16,270,509	Q72P	possibly damaging	Het
Nol4	T	A	18: 22,952,201	Q52L	probably damaging	Het
Nrcam	T	C	12: 44,571,633	V808A	probably damaging	Het
Olfr1058	A	T	2: 86,385,797	L207*	probably null	Het
Olfr9	A	G	10: 128,990,440	H176R	probably damaging	Het
Olfr993	A	T	2: 85,414,165	F238Y	probably damaging	Het
Pik3c2b	C	A	1: 133,088,308	D869E	probably benign	Het
Pom121l2	T	C	13: 21,983,376	S606P	probably damaging	Het
Prdm15	G	A	16: 97,812,570	R517*	probably null	Het
Ralgapa1	T	A	12: 55,770,616		probably null	Het
Saraf	T	A	8: 34,165,387	F207I	probably benign	Het
Sema6d	A	G	2: 124,664,708	D874G	probably damaging	Het
Sfrp5	A	T	19: 42,201,972	L14M	unknown	Het
Sidt1	A	T	16: 44,263,312	C485*	probably null	Het
Sptbn4	A	G	7: 27,372,171	Y1618H	probably damaging	Het
Syt14	T	C	1: 192,980,408	Q127R	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Ticrr	G	A	7: 79,660,955	A206T	probably damaging	Het
Tmem132d	T	A	5: 127,784,598	I820F	probably benign	Het
Trafd1	A	G	5: 121,373,457	Y433H	probably damaging	Het
Trim68	A	G	7: 102,678,831	V305A	probably damaging	Het
Vmn2r58	T	A	7: 41,865,056	Y163F	possibly damaging	Het
Vmn2r83	T	A	10: 79,478,792	H291Q	probably benign	Het
Vmn2r95	A	G	17: 18,441,362	I457V	probably benign	Het

Other mutations in Cep104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02755:Cep104	APN	4	153996959	missense	possibly damaging	0.93
IGL02884:Cep104	APN	4	153989862	missense	probably damaging	0.96
IGL02928:Cep104	APN	4	153981259	missense	probably benign	0.18
IGL03119:Cep104	APN	4	153981724	missense	probably damaging	1.00
R0409:Cep104	UTSW	4	153983053	splice site	probably benign
R0505:Cep104	UTSW	4	153996304	missense	probably benign	0.00
R0600:Cep104	UTSW	4	154006792	missense	possibly damaging	0.58
R1208:Cep104	UTSW	4	153985379	missense	probably damaging	1.00
R1208:Cep104	UTSW	4	153985379	missense	probably damaging	1.00
R1221:Cep104	UTSW	4	153988445	missense	probably benign	0.00
R1338:Cep104	UTSW	4	153994508	missense	probably benign	0.01
R1528:Cep104	UTSW	4	153994508	missense	probably benign	0.01
R1648:Cep104	UTSW	4	153979096	critical splice donor site	probably null
R1831:Cep104	UTSW	4	154002546	missense	probably benign	0.30
R1832:Cep104	UTSW	4	154002546	missense	probably benign	0.30
R1911:Cep104	UTSW	4	154006798	missense	possibly damaging	0.74
R1914:Cep104	UTSW	4	153989839	missense	possibly damaging	0.79
R2516:Cep104	UTSW	4	153989146	missense	probably damaging	1.00
R2910:Cep104	UTSW	4	153995427	splice site	probably null
R2911:Cep104	UTSW	4	153995427	splice site	probably null
R3751:Cep104	UTSW	4	153981756	missense	probably damaging	1.00
R3828:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R3829:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R3830:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R4474:Cep104	UTSW	4	153989236	missense	possibly damaging	0.47
R4731:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R4732:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R4733:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R5306:Cep104	UTSW	4	154006242	missense	probably benign	0.02
R5449:Cep104	UTSW	4	153985305	splice site	probably null
R5567:Cep104	UTSW	4	154002277	missense	possibly damaging	0.64
R5761:Cep104	UTSW	4	153981224	missense	possibly damaging	0.63
R7003:Cep104	UTSW	4	153993561	missense	probably benign	0.00
R7179:Cep104	UTSW	4	153992867	missense	probably damaging	0.99
R7376:Cep104	UTSW	4	153983052	splice site	probably null
R8278:Cep104	UTSW	4	153983665	missense	possibly damaging	0.92
R8877:Cep104	UTSW	4	153993528	missense	probably damaging	0.98
R9035:Cep104	UTSW	4	153979005	missense	probably benign	0.39
R9060:Cep104	UTSW	4	153989824	missense	probably damaging	0.98
R9165:Cep104	UTSW	4	153994514	critical splice donor site	probably null
X0026:Cep104	UTSW	4	153986885	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTCACACTAGTCTGAGAGGAAATG -3'
(R):5'- CACATGTGCATGCCATTGTG -3'

Sequencing Primer
(F):5'- AGGAAATGGATGACCTTTCTCCTGC -3'
(R):5'- CATGCCATTGTGATTGTGTGCATAAC -3'

Posted On

2017-06-26