Incidental Mutation 'R5980:Cntn6'
ID 481376
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission 044162-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R5980 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 104469751-104840367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104825093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 878 (S878P)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect probably damaging
Transcript: ENSMUST00000089215
AA Change: S878P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: S878P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161070
AA Change: S806P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: S806P

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162872
AA Change: S878P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: S878P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,544,018 (GRCm39) N508D possibly damaging Het
Ago1 C T 4: 126,354,362 (GRCm39) probably benign Het
Apol6 A T 15: 76,935,219 (GRCm39) T163S possibly damaging Het
Arhgap27 T C 11: 103,247,095 (GRCm39) T33A probably benign Het
Atg7 C A 6: 114,657,197 (GRCm39) F132L possibly damaging Het
Cep104 C A 4: 154,072,930 (GRCm39) A396E probably benign Het
Cers4 T A 8: 4,568,269 (GRCm39) C107* probably null Het
Dnah6 T C 6: 73,158,705 (GRCm39) K633E probably benign Het
Dst T A 1: 34,221,972 (GRCm39) I2592K probably benign Het
Ep400 G A 5: 110,881,595 (GRCm39) probably benign Het
Fbn1 A G 2: 125,157,324 (GRCm39) C2320R probably damaging Het
Gpi1 A G 7: 33,928,351 (GRCm39) probably null Het
Gse1 T G 8: 120,956,376 (GRCm39) probably benign Het
Hid1 G A 11: 115,241,774 (GRCm39) T612I possibly damaging Het
Ighmbp2 G T 19: 3,315,295 (GRCm39) H708Q probably benign Het
Igkv10-95 T C 6: 68,657,573 (GRCm39) S10P probably damaging Het
Igkv14-100 T C 6: 68,496,009 (GRCm39) V5A probably benign Het
Irgq G A 7: 24,232,770 (GRCm39) G204S probably damaging Het
Kansl1 T C 11: 104,234,463 (GRCm39) K681R possibly damaging Het
Kcnv1 C A 15: 44,972,810 (GRCm39) V358L probably damaging Het
Lrp2 A T 2: 69,365,349 (GRCm39) S275T probably damaging Het
Lysmd1 A T 3: 95,045,219 (GRCm39) D155V probably damaging Het
Magel2 A T 7: 62,030,344 (GRCm39) I1083F unknown Het
Mta3 T A 17: 84,015,834 (GRCm39) V12D probably damaging Het
Mtmr4 T C 11: 87,494,977 (GRCm39) I423T probably damaging Het
Mup11 A G 4: 60,616,887 (GRCm39) Y16H possibly damaging Het
Mycbp G A 4: 123,804,889 (GRCm39) V91I probably benign Het
Ngly1 A C 14: 16,270,509 (GRCm38) Q72P possibly damaging Het
Nol4 T A 18: 23,085,258 (GRCm39) Q52L probably damaging Het
Nrcam T C 12: 44,618,416 (GRCm39) V808A probably damaging Het
Or10p22 A G 10: 128,826,309 (GRCm39) H176R probably damaging Het
Or5ak23 A T 2: 85,244,509 (GRCm39) F238Y probably damaging Het
Or8k24 A T 2: 86,216,141 (GRCm39) L207* probably null Het
Pate10 A C 9: 35,652,911 (GRCm39) D51A probably damaging Het
Pik3c2b C A 1: 133,016,046 (GRCm39) D869E probably benign Het
Pom121l2 T C 13: 22,167,546 (GRCm39) S606P probably damaging Het
Prdm15 G A 16: 97,613,770 (GRCm39) R517* probably null Het
Ralgapa1 T A 12: 55,817,401 (GRCm39) probably null Het
Saraf T A 8: 34,632,541 (GRCm39) F207I probably benign Het
Sema6d A G 2: 124,506,628 (GRCm39) D874G probably damaging Het
Sfrp5 A T 19: 42,190,411 (GRCm39) L14M unknown Het
Sidt1 A T 16: 44,083,675 (GRCm39) C485* probably null Het
Sptbn4 A G 7: 27,071,596 (GRCm39) Y1618H probably damaging Het
Syt14 T C 1: 192,662,716 (GRCm39) Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Ticrr G A 7: 79,310,703 (GRCm39) A206T probably damaging Het
Tmem132d T A 5: 127,861,662 (GRCm39) I820F probably benign Het
Trafd1 A G 5: 121,511,520 (GRCm39) Y433H probably damaging Het
Trim68 A G 7: 102,328,038 (GRCm39) V305A probably damaging Het
Vmn2r58 T A 7: 41,514,480 (GRCm39) Y163F possibly damaging Het
Vmn2r83 T A 10: 79,314,626 (GRCm39) H291Q probably benign Het
Vmn2r95 A G 17: 18,661,624 (GRCm39) I457V probably benign Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104,627,361 (GRCm39) missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104,751,484 (GRCm39) missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104,705,335 (GRCm39) splice site probably benign
IGL02028:Cntn6 APN 6 104,836,387 (GRCm39) missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104,823,103 (GRCm39) critical splice donor site probably null
IGL02557:Cntn6 APN 6 104,751,496 (GRCm39) missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104,781,347 (GRCm39) missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104,781,299 (GRCm39) missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104,753,418 (GRCm39) splice site probably benign
PIT4366001:Cntn6 UTSW 6 104,809,498 (GRCm39) missense probably benign 0.05
R0490:Cntn6 UTSW 6 104,810,879 (GRCm39) missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104,753,275 (GRCm39) missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104,840,109 (GRCm39) missense probably benign 0.00
R0654:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R0960:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R1241:Cntn6 UTSW 6 104,809,470 (GRCm39) missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104,838,861 (GRCm39) missense probably benign 0.07
R1401:Cntn6 UTSW 6 104,781,359 (GRCm39) missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R1542:Cntn6 UTSW 6 104,825,061 (GRCm39) missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104,809,541 (GRCm39) missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104,838,783 (GRCm39) nonsense probably null
R2097:Cntn6 UTSW 6 104,838,910 (GRCm39) missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104,545,989 (GRCm39) start gained probably benign
R2429:Cntn6 UTSW 6 104,627,526 (GRCm39) missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104,703,198 (GRCm39) missense probably benign 0.04
R4009:Cntn6 UTSW 6 104,810,783 (GRCm39) missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104,749,522 (GRCm39) missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4666:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4701:Cntn6 UTSW 6 104,781,321 (GRCm39) missense probably benign 0.01
R4780:Cntn6 UTSW 6 104,822,745 (GRCm39) missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104,836,436 (GRCm39) missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104,751,435 (GRCm39) missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104,749,558 (GRCm39) missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104,809,991 (GRCm39) missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104,546,074 (GRCm39) intron probably benign
R5291:Cntn6 UTSW 6 104,703,096 (GRCm39) missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104,809,523 (GRCm39) missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104,812,706 (GRCm39) missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104,810,064 (GRCm39) missense possibly damaging 0.68
R6290:Cntn6 UTSW 6 104,744,851 (GRCm39) missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104,703,100 (GRCm39) missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104,627,461 (GRCm39) missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104,836,409 (GRCm39) missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104,838,907 (GRCm39) missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104,822,719 (GRCm39) frame shift probably null
R7012:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R7012:Cntn6 UTSW 6 104,703,223 (GRCm39) missense probably damaging 0.98
R7337:Cntn6 UTSW 6 104,627,491 (GRCm39) missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104,627,444 (GRCm39) missense probably benign 0.29
R8133:Cntn6 UTSW 6 104,705,298 (GRCm39) missense probably benign 0.19
R8463:Cntn6 UTSW 6 104,749,580 (GRCm39) missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably benign 0.05
R9232:Cntn6 UTSW 6 104,815,781 (GRCm39) missense probably damaging 1.00
R9287:Cntn6 UTSW 6 104,809,471 (GRCm39) missense possibly damaging 0.89
R9454:Cntn6 UTSW 6 104,781,308 (GRCm39) missense possibly damaging 0.82
R9698:Cntn6 UTSW 6 104,810,044 (GRCm39) nonsense probably null
X0020:Cntn6 UTSW 6 104,744,845 (GRCm39) missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104,809,545 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAAAATTGCCCTGGTTGTC -3'
(R):5'- ACCAAGTAGATGGAACCTTGTGG -3'

Sequencing Primer
(F):5'- AAAATTGCCCTGGTTGTCTTTTATTC -3'
(R):5'- CCTTGTGGTAGGAAGAATGAATGGC -3'
Posted On 2017-06-26