Incidental Mutation 'R5980:Sptbn4'
ID 481380
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Name spectrin beta, non-erythrocytic 4
Synonyms ROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission 044162-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.464) question?
Stock # R5980 (G1)
Quality Score 114.008
Status Not validated
Chromosome 7
Chromosomal Location 27356383-27447686 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27372171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1618 (Y1618H)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
AlphaFold E9PX29
Predicted Effect probably damaging
Transcript: ENSMUST00000011895
AA Change: Y1623H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: Y1623H

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108362
AA Change: Y303H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: Y303H

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108363
AA Change: Y303H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: Y303H

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108364
AA Change: Y303H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: Y303H

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172269
AA Change: Y1618H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: Y1618H

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 (GRCm38) N508D possibly damaging Het
Ago1 C T 4: 126,460,569 (GRCm38) probably benign Het
Apol6 A T 15: 77,051,019 (GRCm38) T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 (GRCm38) T33A probably benign Het
Atg7 C A 6: 114,680,236 (GRCm38) F132L possibly damaging Het
Cep104 C A 4: 153,988,473 (GRCm38) A396E probably benign Het
Cers4 T A 8: 4,518,269 (GRCm38) C107* probably null Het
Cntn6 T C 6: 104,848,132 (GRCm38) S878P probably damaging Het
Dnah6 T C 6: 73,181,722 (GRCm38) K633E probably benign Het
Dst T A 1: 34,182,891 (GRCm38) I2592K probably benign Het
Ep400 G A 5: 110,733,729 (GRCm38) probably benign Het
Fbn1 A G 2: 125,315,404 (GRCm38) C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 (GRCm38) D51A probably damaging Het
Gpi1 A G 7: 34,228,926 (GRCm38) probably null Het
Gse1 T G 8: 120,229,637 (GRCm38) probably benign Het
Hid1 G A 11: 115,350,948 (GRCm38) T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 (GRCm38) H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 (GRCm38) S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 (GRCm38) V5A probably benign Het
Irgq G A 7: 24,533,345 (GRCm38) G204S probably damaging Het
Kansl1 T C 11: 104,343,637 (GRCm38) K681R possibly damaging Het
Kcnv1 C A 15: 45,109,414 (GRCm38) V358L probably damaging Het
Lrp2 A T 2: 69,535,005 (GRCm38) S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 (GRCm38) D155V probably damaging Het
Magel2 A T 7: 62,380,596 (GRCm38) I1083F unknown Het
Mta3 T A 17: 83,708,405 (GRCm38) V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 (GRCm38) I423T probably damaging Het
Mup11 A G 4: 60,660,888 (GRCm38) Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 (GRCm38) V91I probably benign Het
Ngly1 A C 14: 16,270,509 (GRCm38) Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 (GRCm38) Q52L probably damaging Het
Nrcam T C 12: 44,571,633 (GRCm38) V808A probably damaging Het
Olfr1058 A T 2: 86,385,797 (GRCm38) L207* probably null Het
Olfr9 A G 10: 128,990,440 (GRCm38) H176R probably damaging Het
Olfr993 A T 2: 85,414,165 (GRCm38) F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 (GRCm38) D869E probably benign Het
Pom121l2 T C 13: 21,983,376 (GRCm38) S606P probably damaging Het
Prdm15 G A 16: 97,812,570 (GRCm38) R517* probably null Het
Ralgapa1 T A 12: 55,770,616 (GRCm38) probably null Het
Saraf T A 8: 34,165,387 (GRCm38) F207I probably benign Het
Sema6d A G 2: 124,664,708 (GRCm38) D874G probably damaging Het
Sfrp5 A T 19: 42,201,972 (GRCm38) L14M unknown Het
Sidt1 A T 16: 44,263,312 (GRCm38) C485* probably null Het
Syt14 T C 1: 192,980,408 (GRCm38) Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm38) G252R probably benign Het
Ticrr G A 7: 79,660,955 (GRCm38) A206T probably damaging Het
Tmem132d T A 5: 127,784,598 (GRCm38) I820F probably benign Het
Trafd1 A G 5: 121,373,457 (GRCm38) Y433H probably damaging Het
Trim68 A G 7: 102,678,831 (GRCm38) V305A probably damaging Het
Vmn2r58 T A 7: 41,865,056 (GRCm38) Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 (GRCm38) H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 (GRCm38) I457V probably benign Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27,369,434 (GRCm38) missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27,417,965 (GRCm38) missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27,414,771 (GRCm38) missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27,404,268 (GRCm38) missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27,364,146 (GRCm38) missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27,364,515 (GRCm38) missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27,364,357 (GRCm38) missense probably benign
IGL02226:Sptbn4 APN 7 27,365,707 (GRCm38) missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27,364,299 (GRCm38) missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27,428,247 (GRCm38) missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27,365,589 (GRCm38) missense probably null 0.15
IGL02487:Sptbn4 APN 7 27,419,097 (GRCm38) missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27,391,551 (GRCm38) missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27,367,679 (GRCm38) missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27,426,833 (GRCm38) missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27,426,833 (GRCm38) missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27,394,148 (GRCm38) splice site probably benign
IGL02961:Sptbn4 APN 7 27,397,967 (GRCm38) missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27,357,387 (GRCm38) nonsense probably null
R0194:Sptbn4 UTSW 7 27,404,911 (GRCm38) missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27,364,170 (GRCm38) missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27,359,736 (GRCm38) splice site probably benign
R0510:Sptbn4 UTSW 7 27,361,566 (GRCm38) critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27,364,378 (GRCm38) missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27,408,328 (GRCm38) nonsense probably null
R1336:Sptbn4 UTSW 7 27,417,963 (GRCm38) missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27,434,294 (GRCm38) missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27,418,739 (GRCm38) missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27,418,583 (GRCm38) missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27,366,646 (GRCm38) missense probably null 0.96
R1906:Sptbn4 UTSW 7 27,391,431 (GRCm38) critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27,407,138 (GRCm38) missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27,366,443 (GRCm38) missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27,367,702 (GRCm38) missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27,423,810 (GRCm38) missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27,366,419 (GRCm38) nonsense probably null
R2083:Sptbn4 UTSW 7 27,428,256 (GRCm38) missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27,364,162 (GRCm38) missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27,367,609 (GRCm38) missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27,434,357 (GRCm38) missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27,434,357 (GRCm38) missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27,360,092 (GRCm38) missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27,418,098 (GRCm38) nonsense probably null
R4115:Sptbn4 UTSW 7 27,391,570 (GRCm38) missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27,391,570 (GRCm38) missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27,418,471 (GRCm38) missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27,423,798 (GRCm38) missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27,367,702 (GRCm38) missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27,366,735 (GRCm38) missense possibly damaging 0.60
R4684:Sptbn4 UTSW 7 27,364,419 (GRCm38) missense probably damaging 0.96
R4707:Sptbn4 UTSW 7 27,417,006 (GRCm38) missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27,372,152 (GRCm38) missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27,369,391 (GRCm38) missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27,359,741 (GRCm38) critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27,366,428 (GRCm38) missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27,418,713 (GRCm38) missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27,404,253 (GRCm38) missense probably benign 0.00
R6005:Sptbn4 UTSW 7 27,418,599 (GRCm38) missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27,364,479 (GRCm38) missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27,364,170 (GRCm38) missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27,364,170 (GRCm38) missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27,360,088 (GRCm38) missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27,364,587 (GRCm38) nonsense probably null
R6762:Sptbn4 UTSW 7 27,394,208 (GRCm38) missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27,371,950 (GRCm38) missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27,418,056 (GRCm38) missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27,416,785 (GRCm38) missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27,366,689 (GRCm38) missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27,409,014 (GRCm38) missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27,428,268 (GRCm38) missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27,375,590 (GRCm38) missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27,442,535 (GRCm38) missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27,372,272 (GRCm38) missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27,361,577 (GRCm38) missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27,364,336 (GRCm38) missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27,361,634 (GRCm38) missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27,362,410 (GRCm38) missense probably benign
R8002:Sptbn4 UTSW 7 27,417,992 (GRCm38) missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27,364,269 (GRCm38) missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27,375,383 (GRCm38) missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27,408,889 (GRCm38) nonsense probably null
R8353:Sptbn4 UTSW 7 27,404,238 (GRCm38) missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27,372,296 (GRCm38) missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27,404,238 (GRCm38) missense probably damaging 1.00
R8815:Sptbn4 UTSW 7 27,407,232 (GRCm38) nonsense probably null
R8818:Sptbn4 UTSW 7 27,364,167 (GRCm38) missense possibly damaging 0.71
R9171:Sptbn4 UTSW 7 27,442,419 (GRCm38) missense possibly damaging 0.95
R9259:Sptbn4 UTSW 7 27,367,699 (GRCm38) missense possibly damaging 0.74
R9477:Sptbn4 UTSW 7 27,433,199 (GRCm38) missense possibly damaging 0.79
R9564:Sptbn4 UTSW 7 27,418,079 (GRCm38) missense probably damaging 0.98
R9572:Sptbn4 UTSW 7 27,366,670 (GRCm38) missense probably benign 0.16
R9623:Sptbn4 UTSW 7 27,408,382 (GRCm38) missense probably damaging 1.00
R9715:Sptbn4 UTSW 7 27,391,575 (GRCm38) missense probably damaging 1.00
R9782:Sptbn4 UTSW 7 27,408,568 (GRCm38) missense probably benign 0.02
R9790:Sptbn4 UTSW 7 27,372,237 (GRCm38) missense probably damaging 0.99
R9791:Sptbn4 UTSW 7 27,372,237 (GRCm38) missense probably damaging 0.99
R9798:Sptbn4 UTSW 7 27,357,292 (GRCm38) makesense probably null
X0020:Sptbn4 UTSW 7 27,402,734 (GRCm38) critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27,357,311 (GRCm38) unclassified probably benign
Z1176:Sptbn4 UTSW 7 27,360,025 (GRCm38) missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27,409,102 (GRCm38) missense probably benign 0.41
Z1177:Sptbn4 UTSW 7 27,404,582 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGTTCATCCTGGAAGCAC -3'
(R):5'- ACCCGATGTCTCATTCGCAG -3'

Sequencing Primer
(F):5'- GTTCATCCTGGAAGCACAAGGC -3'
(R):5'- ATGTCTCATTCGCAGGGCCTG -3'
Posted On 2017-06-26