Incidental Mutation 'R5980:Ticrr'
ID 481384
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 044162-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R5980 (G1)
Quality Score 192.009
Status Validated
Chromosome 7
Chromosomal Location 79660196-79698148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79660955 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 206 (A206T)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: A206T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: A206T

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205750
Predicted Effect probably benign
Transcript: ENSMUST00000206017
AA Change: A206T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000206591
AA Change: A206T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
AA Change: A206T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.1129 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 N508D possibly damaging Het
Ago1 C T 4: 126,460,569 probably benign Het
Apol6 A T 15: 77,051,019 T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 T33A probably benign Het
Atg7 C A 6: 114,680,236 F132L possibly damaging Het
Cep104 C A 4: 153,988,473 A396E probably benign Het
Cers4 T A 8: 4,518,269 C107* probably null Het
Cntn6 T C 6: 104,848,132 S878P probably damaging Het
Dnah6 T C 6: 73,181,722 K633E probably benign Het
Dst T A 1: 34,182,891 I2592K probably benign Het
Ep400 G A 5: 110,733,729 probably benign Het
Fbn1 A G 2: 125,315,404 C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 D51A probably damaging Het
Gpi1 A G 7: 34,228,926 probably null Het
Gse1 T G 8: 120,229,637 probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 V5A probably benign Het
Irgq G A 7: 24,533,345 G204S probably damaging Het
Kansl1 T C 11: 104,343,637 K681R possibly damaging Het
Kcnv1 C A 15: 45,109,414 V358L probably damaging Het
Lrp2 A T 2: 69,535,005 S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 D155V probably damaging Het
Magel2 A T 7: 62,380,596 I1083F unknown Het
Mta3 T A 17: 83,708,405 V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 I423T probably damaging Het
Mup11 A G 4: 60,660,888 Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 V91I probably benign Het
Ngly1 A C 14: 16,270,509 Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 Q52L probably damaging Het
Nrcam T C 12: 44,571,633 V808A probably damaging Het
Olfr1058 A T 2: 86,385,797 L207* probably null Het
Olfr9 A G 10: 128,990,440 H176R probably damaging Het
Olfr993 A T 2: 85,414,165 F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 D869E probably benign Het
Pom121l2 T C 13: 21,983,376 S606P probably damaging Het
Prdm15 G A 16: 97,812,570 R517* probably null Het
Ralgapa1 T A 12: 55,770,616 probably null Het
Saraf T A 8: 34,165,387 F207I probably benign Het
Sema6d A G 2: 124,664,708 D874G probably damaging Het
Sfrp5 A T 19: 42,201,972 L14M unknown Het
Sidt1 A T 16: 44,263,312 C485* probably null Het
Sptbn4 A G 7: 27,372,171 Y1618H probably damaging Het
Syt14 T C 1: 192,980,408 Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmem132d T A 5: 127,784,598 I820F probably benign Het
Trafd1 A G 5: 121,373,457 Y433H probably damaging Het
Trim68 A G 7: 102,678,831 V305A probably damaging Het
Vmn2r58 T A 7: 41,865,056 Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 I457V probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
R9073:Ticrr UTSW 7 79667931 missense probably benign 0.01
R9090:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79693768 missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79680987 missense probably damaging 0.99
R9469:Ticrr UTSW 7 79694763 missense probably benign 0.03
R9502:Ticrr UTSW 7 79693849 missense probably benign
R9614:Ticrr UTSW 7 79696006 missense probably damaging 1.00
R9761:Ticrr UTSW 7 79695565 missense probably damaging 1.00
R9779:Ticrr UTSW 7 79679054 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCAAGTTCTTCGACTCTCAGGG -3'
(R):5'- TGGAGGAACGCTGTCCTTTG -3'

Sequencing Primer
(F):5'- ATGGAGACGCTGCTCGACTAC -3'
(R):5'- GCTGTCCTTTGCGACCCG -3'
Posted On 2017-06-26