Incidental Mutation 'R5980:Trim68'
ID481385
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
MMRRC Submission 044162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5980 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102678831 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 305 (V305A)
Ref Sequence ENSEMBL: ENSMUSP00000080813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
Predicted Effect probably damaging
Transcript: ENSMUST00000082175
AA Change: V305A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968
AA Change: V305A

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210406
Predicted Effect silent
Transcript: ENSMUST00000210855
Meta Mutation Damage Score 0.8811 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 N508D possibly damaging Het
Ago1 C T 4: 126,460,569 probably benign Het
Apol6 A T 15: 77,051,019 T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 T33A probably benign Het
Atg7 C A 6: 114,680,236 F132L possibly damaging Het
Cep104 C A 4: 153,988,473 A396E probably benign Het
Cers4 T A 8: 4,518,269 C107* probably null Het
Cntn6 T C 6: 104,848,132 S878P probably damaging Het
Dnah6 T C 6: 73,181,722 K633E probably benign Het
Dst T A 1: 34,182,891 I2592K probably benign Het
Ep400 G A 5: 110,733,729 probably benign Het
Fbn1 A G 2: 125,315,404 C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 D51A probably damaging Het
Gpi1 A G 7: 34,228,926 probably null Het
Gse1 T G 8: 120,229,637 probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 V5A probably benign Het
Irgq G A 7: 24,533,345 G204S probably damaging Het
Kansl1 T C 11: 104,343,637 K681R possibly damaging Het
Kcnv1 C A 15: 45,109,414 V358L probably damaging Het
Lrp2 A T 2: 69,535,005 S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 D155V probably damaging Het
Magel2 A T 7: 62,380,596 I1083F unknown Het
Mta3 T A 17: 83,708,405 V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 I423T probably damaging Het
Mup11 A G 4: 60,660,888 Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 V91I probably benign Het
Ngly1 A C 14: 16,270,509 Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 Q52L probably damaging Het
Nrcam T C 12: 44,571,633 V808A probably damaging Het
Olfr1058 A T 2: 86,385,797 L207* probably null Het
Olfr9 A G 10: 128,990,440 H176R probably damaging Het
Olfr993 A T 2: 85,414,165 F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 D869E probably benign Het
Pom121l2 T C 13: 21,983,376 S606P probably damaging Het
Prdm15 G A 16: 97,812,570 R517* probably null Het
Ralgapa1 T A 12: 55,770,616 probably null Het
Saraf T A 8: 34,165,387 F207I probably benign Het
Sema6d A G 2: 124,664,708 D874G probably damaging Het
Sfrp5 A T 19: 42,201,972 L14M unknown Het
Sidt1 A T 16: 44,263,312 C485* probably null Het
Sptbn4 A G 7: 27,372,171 Y1618H probably damaging Het
Syt14 T C 1: 192,980,408 Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Ticrr G A 7: 79,660,955 A206T probably damaging Het
Tmem132d T A 5: 127,784,598 I820F probably benign Het
Trafd1 A G 5: 121,373,457 Y433H probably damaging Het
Vmn2r58 T A 7: 41,865,056 Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 I457V probably benign Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5793:Trim68 UTSW 7 102684353 missense possibly damaging 0.74
R6749:Trim68 UTSW 7 102678783 missense probably damaging 0.99
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7789:Trim68 UTSW 7 102684469 missense possibly damaging 0.61
R7892:Trim68 UTSW 7 102678797 missense unknown
R8096:Trim68 UTSW 7 102678442 missense probably damaging 1.00
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCTACCTCCCAGTAGTG -3'
(R):5'- ACCCTGAAGACATTTGCAGG -3'

Sequencing Primer
(F):5'- CTCCCAGTAGTGCCGGC -3'
(R):5'- CCCTGAAGACATTTGCAGGTATTAG -3'
Posted On2017-06-26