Incidental Mutation 'R5980:Vmn2r83'
ID 481390
Institutional Source Beutler Lab
Gene Symbol Vmn2r83
Ensembl Gene ENSMUSG00000091381
Gene Name vomeronasal 2, receptor 83
Synonyms EG625029
MMRRC Submission 044162-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R5980 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 79304792-79327988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79314626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 291 (H291Q)
Ref Sequence ENSEMBL: ENSMUSP00000131426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167976]
AlphaFold E9Q0G7
Predicted Effect probably benign
Transcript: ENSMUST00000167976
AA Change: H291Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131426
Gene: ENSMUSG00000091381
AA Change: H291Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 473 1.5e-33 PFAM
Pfam:NCD3G 516 569 6.2e-22 PFAM
Pfam:7tm_3 602 837 8.1e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,544,018 (GRCm39) N508D possibly damaging Het
Ago1 C T 4: 126,354,362 (GRCm39) probably benign Het
Apol6 A T 15: 76,935,219 (GRCm39) T163S possibly damaging Het
Arhgap27 T C 11: 103,247,095 (GRCm39) T33A probably benign Het
Atg7 C A 6: 114,657,197 (GRCm39) F132L possibly damaging Het
Cep104 C A 4: 154,072,930 (GRCm39) A396E probably benign Het
Cers4 T A 8: 4,568,269 (GRCm39) C107* probably null Het
Cntn6 T C 6: 104,825,093 (GRCm39) S878P probably damaging Het
Dnah6 T C 6: 73,158,705 (GRCm39) K633E probably benign Het
Dst T A 1: 34,221,972 (GRCm39) I2592K probably benign Het
Ep400 G A 5: 110,881,595 (GRCm39) probably benign Het
Fbn1 A G 2: 125,157,324 (GRCm39) C2320R probably damaging Het
Gpi1 A G 7: 33,928,351 (GRCm39) probably null Het
Gse1 T G 8: 120,956,376 (GRCm39) probably benign Het
Hid1 G A 11: 115,241,774 (GRCm39) T612I possibly damaging Het
Ighmbp2 G T 19: 3,315,295 (GRCm39) H708Q probably benign Het
Igkv10-95 T C 6: 68,657,573 (GRCm39) S10P probably damaging Het
Igkv14-100 T C 6: 68,496,009 (GRCm39) V5A probably benign Het
Irgq G A 7: 24,232,770 (GRCm39) G204S probably damaging Het
Kansl1 T C 11: 104,234,463 (GRCm39) K681R possibly damaging Het
Kcnv1 C A 15: 44,972,810 (GRCm39) V358L probably damaging Het
Lrp2 A T 2: 69,365,349 (GRCm39) S275T probably damaging Het
Lysmd1 A T 3: 95,045,219 (GRCm39) D155V probably damaging Het
Magel2 A T 7: 62,030,344 (GRCm39) I1083F unknown Het
Mta3 T A 17: 84,015,834 (GRCm39) V12D probably damaging Het
Mtmr4 T C 11: 87,494,977 (GRCm39) I423T probably damaging Het
Mup11 A G 4: 60,616,887 (GRCm39) Y16H possibly damaging Het
Mycbp G A 4: 123,804,889 (GRCm39) V91I probably benign Het
Ngly1 A C 14: 16,270,509 (GRCm38) Q72P possibly damaging Het
Nol4 T A 18: 23,085,258 (GRCm39) Q52L probably damaging Het
Nrcam T C 12: 44,618,416 (GRCm39) V808A probably damaging Het
Or10p22 A G 10: 128,826,309 (GRCm39) H176R probably damaging Het
Or5ak23 A T 2: 85,244,509 (GRCm39) F238Y probably damaging Het
Or8k24 A T 2: 86,216,141 (GRCm39) L207* probably null Het
Pate10 A C 9: 35,652,911 (GRCm39) D51A probably damaging Het
Pik3c2b C A 1: 133,016,046 (GRCm39) D869E probably benign Het
Pom121l2 T C 13: 22,167,546 (GRCm39) S606P probably damaging Het
Prdm15 G A 16: 97,613,770 (GRCm39) R517* probably null Het
Ralgapa1 T A 12: 55,817,401 (GRCm39) probably null Het
Saraf T A 8: 34,632,541 (GRCm39) F207I probably benign Het
Sema6d A G 2: 124,506,628 (GRCm39) D874G probably damaging Het
Sfrp5 A T 19: 42,190,411 (GRCm39) L14M unknown Het
Sidt1 A T 16: 44,083,675 (GRCm39) C485* probably null Het
Sptbn4 A G 7: 27,071,596 (GRCm39) Y1618H probably damaging Het
Syt14 T C 1: 192,662,716 (GRCm39) Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Ticrr G A 7: 79,310,703 (GRCm39) A206T probably damaging Het
Tmem132d T A 5: 127,861,662 (GRCm39) I820F probably benign Het
Trafd1 A G 5: 121,511,520 (GRCm39) Y433H probably damaging Het
Trim68 A G 7: 102,328,038 (GRCm39) V305A probably damaging Het
Vmn2r58 T A 7: 41,514,480 (GRCm39) Y163F possibly damaging Het
Vmn2r95 A G 17: 18,661,624 (GRCm39) I457V probably benign Het
Other mutations in Vmn2r83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Vmn2r83 APN 10 79,314,805 (GRCm39) missense probably damaging 1.00
IGL01096:Vmn2r83 APN 10 79,313,662 (GRCm39) missense probably damaging 1.00
IGL01542:Vmn2r83 APN 10 79,314,846 (GRCm39) missense probably benign 0.30
IGL01803:Vmn2r83 APN 10 79,304,894 (GRCm39) missense probably benign 0.01
IGL02110:Vmn2r83 APN 10 79,327,534 (GRCm39) missense possibly damaging 0.82
IGL02347:Vmn2r83 APN 10 79,316,067 (GRCm39) missense possibly damaging 0.75
IGL02417:Vmn2r83 APN 10 79,314,881 (GRCm39) missense probably benign 0.00
IGL02544:Vmn2r83 APN 10 79,317,293 (GRCm39) splice site probably benign
IGL02683:Vmn2r83 APN 10 79,327,115 (GRCm39) missense probably benign
IGL02976:Vmn2r83 APN 10 79,304,832 (GRCm39) missense probably benign 0.00
PIT4378001:Vmn2r83 UTSW 10 79,304,849 (GRCm39) missense probably benign 0.00
PIT4468001:Vmn2r83 UTSW 10 79,313,884 (GRCm39) missense probably damaging 1.00
R0092:Vmn2r83 UTSW 10 79,327,798 (GRCm39) missense probably damaging 1.00
R1391:Vmn2r83 UTSW 10 79,314,931 (GRCm39) missense probably damaging 0.96
R1539:Vmn2r83 UTSW 10 79,327,759 (GRCm39) missense probably damaging 1.00
R1575:Vmn2r83 UTSW 10 79,314,956 (GRCm39) missense probably damaging 0.98
R2033:Vmn2r83 UTSW 10 79,327,653 (GRCm39) missense probably benign 0.03
R3916:Vmn2r83 UTSW 10 79,314,744 (GRCm39) missense probably benign 0.01
R3967:Vmn2r83 UTSW 10 79,327,154 (GRCm39) missense probably benign 0.00
R4840:Vmn2r83 UTSW 10 79,313,682 (GRCm39) missense possibly damaging 0.73
R5063:Vmn2r83 UTSW 10 79,314,921 (GRCm39) missense probably benign 0.04
R5630:Vmn2r83 UTSW 10 79,327,785 (GRCm39) missense possibly damaging 0.94
R5707:Vmn2r83 UTSW 10 79,327,183 (GRCm39) missense possibly damaging 0.53
R6294:Vmn2r83 UTSW 10 79,313,688 (GRCm39) missense probably damaging 0.99
R6302:Vmn2r83 UTSW 10 79,304,837 (GRCm39) missense possibly damaging 0.95
R6769:Vmn2r83 UTSW 10 79,313,856 (GRCm39) missense probably damaging 1.00
R6986:Vmn2r83 UTSW 10 79,316,093 (GRCm39) missense probably benign
R7221:Vmn2r83 UTSW 10 79,316,001 (GRCm39) missense probably benign 0.02
R7376:Vmn2r83 UTSW 10 79,314,790 (GRCm39) missense probably benign 0.00
R7431:Vmn2r83 UTSW 10 79,327,306 (GRCm39) missense probably damaging 0.99
R7501:Vmn2r83 UTSW 10 79,327,771 (GRCm39) missense probably damaging 0.98
R7526:Vmn2r83 UTSW 10 79,327,392 (GRCm39) missense probably damaging 1.00
R7663:Vmn2r83 UTSW 10 79,314,956 (GRCm39) missense probably damaging 0.98
R7881:Vmn2r83 UTSW 10 79,314,261 (GRCm39) missense probably benign 0.01
R7939:Vmn2r83 UTSW 10 79,314,651 (GRCm39) missense probably damaging 1.00
R8314:Vmn2r83 UTSW 10 79,317,313 (GRCm39) missense possibly damaging 0.76
R8364:Vmn2r83 UTSW 10 79,316,037 (GRCm39) missense probably benign 0.12
R8802:Vmn2r83 UTSW 10 79,314,261 (GRCm39) missense probably benign 0.01
R8947:Vmn2r83 UTSW 10 79,304,873 (GRCm39) missense probably benign 0.00
R8969:Vmn2r83 UTSW 10 79,313,853 (GRCm39) missense probably benign 0.15
R8983:Vmn2r83 UTSW 10 79,327,360 (GRCm39) missense probably damaging 1.00
R9018:Vmn2r83 UTSW 10 79,316,020 (GRCm39) missense probably damaging 1.00
R9082:Vmn2r83 UTSW 10 79,304,894 (GRCm39) missense probably benign 0.00
R9390:Vmn2r83 UTSW 10 79,317,322 (GRCm39) nonsense probably null
X0026:Vmn2r83 UTSW 10 79,314,486 (GRCm39) missense probably benign
X0026:Vmn2r83 UTSW 10 79,304,849 (GRCm39) missense probably benign 0.00
Z1176:Vmn2r83 UTSW 10 79,314,756 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GACTGCTCAGCACAGATGAC -3'
(R):5'- TACTTGAAAGGAGTGGCTTCATGC -3'

Sequencing Primer
(F):5'- CAGAGGTGCTCAGTTTCTATCAGAC -3'
(R):5'- GAGTGGCTTCATGCACAAAATTAGTG -3'
Posted On 2017-06-26