Incidental Mutation 'R5980:Kansl1'
ID 481394
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene Name KAT8 regulatory NSL complex subunit 1
Synonyms 1700081L11Rik
MMRRC Submission 044162-MU
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5980 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 104333229-104468861 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104343637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 681 (K681R)
Ref Sequence ENSEMBL: ENSMUSP00000102585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]
AlphaFold Q80TG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000018556
AA Change: K681R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: K681R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069188
Predicted Effect possibly damaging
Transcript: ENSMUST00000106971
AA Change: K681R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: K681R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106972
AA Change: K681R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: K681R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106977
AA Change: K681R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: K681R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 N508D possibly damaging Het
Ago1 C T 4: 126,460,569 probably benign Het
Apol6 A T 15: 77,051,019 T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 T33A probably benign Het
Atg7 C A 6: 114,680,236 F132L possibly damaging Het
Cep104 C A 4: 153,988,473 A396E probably benign Het
Cers4 T A 8: 4,518,269 C107* probably null Het
Cntn6 T C 6: 104,848,132 S878P probably damaging Het
Dnah6 T C 6: 73,181,722 K633E probably benign Het
Dst T A 1: 34,182,891 I2592K probably benign Het
Ep400 G A 5: 110,733,729 probably benign Het
Fbn1 A G 2: 125,315,404 C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 D51A probably damaging Het
Gpi1 A G 7: 34,228,926 probably null Het
Gse1 T G 8: 120,229,637 probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 V5A probably benign Het
Irgq G A 7: 24,533,345 G204S probably damaging Het
Kcnv1 C A 15: 45,109,414 V358L probably damaging Het
Lrp2 A T 2: 69,535,005 S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 D155V probably damaging Het
Magel2 A T 7: 62,380,596 I1083F unknown Het
Mta3 T A 17: 83,708,405 V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 I423T probably damaging Het
Mup11 A G 4: 60,660,888 Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 V91I probably benign Het
Ngly1 A C 14: 16,270,509 Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 Q52L probably damaging Het
Nrcam T C 12: 44,571,633 V808A probably damaging Het
Olfr1058 A T 2: 86,385,797 L207* probably null Het
Olfr9 A G 10: 128,990,440 H176R probably damaging Het
Olfr993 A T 2: 85,414,165 F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 D869E probably benign Het
Pom121l2 T C 13: 21,983,376 S606P probably damaging Het
Prdm15 G A 16: 97,812,570 R517* probably null Het
Ralgapa1 T A 12: 55,770,616 probably null Het
Saraf T A 8: 34,165,387 F207I probably benign Het
Sema6d A G 2: 124,664,708 D874G probably damaging Het
Sfrp5 A T 19: 42,201,972 L14M unknown Het
Sidt1 A T 16: 44,263,312 C485* probably null Het
Sptbn4 A G 7: 27,372,171 Y1618H probably damaging Het
Syt14 T C 1: 192,980,408 Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Ticrr G A 7: 79,660,955 A206T probably damaging Het
Tmem132d T A 5: 127,784,598 I820F probably benign Het
Trafd1 A G 5: 121,373,457 Y433H probably damaging Het
Trim68 A G 7: 102,678,831 V305A probably damaging Het
Vmn2r58 T A 7: 41,865,056 Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 I457V probably benign Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0747:Kansl1 UTSW 11 104342976 missense probably benign 0.00
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1922:Kansl1 UTSW 11 104343640 missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104378689 missense probably benign 0.19
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104343042 missense probably benign
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104424342 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
R7751:Kansl1 UTSW 11 104424064 missense probably benign 0.30
R7880:Kansl1 UTSW 11 104424153 missense probably damaging 1.00
R7888:Kansl1 UTSW 11 104342422 missense probably benign 0.00
R7935:Kansl1 UTSW 11 104424286 missense probably damaging 0.99
R8251:Kansl1 UTSW 11 104424360 missense probably benign
R9033:Kansl1 UTSW 11 104357530 missense probably benign 0.00
R9192:Kansl1 UTSW 11 104336316 missense probably damaging 1.00
R9494:Kansl1 UTSW 11 104356740 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGTAGCAATAGTGATTCCAGAG -3'
(R):5'- TGGCTCTTCCATATGGCAGC -3'

Sequencing Primer
(F):5'- AGGATTCCTCAGTGCCTGGAAAC -3'
(R):5'- GGCAAGTGAGACTACTTGTTAAACC -3'
Posted On 2017-06-26