Incidental Mutation 'R0514:Parg'
ID48141
Institutional Source Beutler Lab
Gene Symbol Parg
Ensembl Gene ENSMUSG00000021911
Gene Namepoly (ADP-ribose) glycohydrolase
Synonyms
MMRRC Submission 038708-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0514 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32201949-32297550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32254560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 186 (T186K)
Ref Sequence ENSEMBL: ENSMUSP00000132454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022470] [ENSMUST00000163350] [ENSMUST00000170129] [ENSMUST00000170840]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022470
AA Change: T691K

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022470
Gene: ENSMUSG00000021911
AA Change: T691K

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 574 902 2.5e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163350
AA Change: T691K

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131566
Gene: ENSMUSG00000021911
AA Change: T691K

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 570 905 5.1e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163957
Predicted Effect probably benign
Transcript: ENSMUST00000170129
Predicted Effect possibly damaging
Transcript: ENSMUST00000170840
AA Change: T186K

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132454
Gene: ENSMUSG00000021911
AA Change: T186K

DomainStartEndE-ValueType
Pfam:PARG_cat 117 452 9.7e-135 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) glycohydrolase (PARG) is the major enzyme responsible for the catabolism of poly(ADP-ribose), a reversible covalent-modifier of chromosomal proteins. The protein is found in many tissues and may be subject to proteolysis generating smaller, active products. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for one allele of this gene are hypersensitive to alkylating agents and ionizing radiation and susceptible to streptozotocin induced diabetes and endotoxic shock. Mice homozygous for a second allele display embryonic lethality and fail tohatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,319,978 Y154F probably damaging Het
Acsl6 A T 11: 54,350,580 D579V probably damaging Het
Adamts18 C T 8: 113,738,769 probably null Het
Adamts20 A T 15: 94,270,376 V1882D probably damaging Het
Add3 A T 19: 53,236,843 K465* probably null Het
Ago1 T G 4: 126,439,595 I524L probably benign Het
Akr1c18 A G 13: 4,137,191 M208T probably benign Het
Anapc1 C A 2: 128,632,655 L1413F probably damaging Het
Arid4b A T 13: 14,184,317 D646V probably damaging Het
Arnt2 T C 7: 84,304,859 E261G probably benign Het
Bccip C T 7: 133,719,130 T211I possibly damaging Het
Bsn T C 9: 108,125,782 S475G probably benign Het
Cdh26 G A 2: 178,466,828 probably null Het
Ceacam2 A G 7: 25,520,931 F414S probably benign Het
Cfb T C 17: 34,860,898 R172G probably damaging Het
Cntnap5b A C 1: 99,772,786 T8P probably benign Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crtc1 A T 8: 70,402,429 probably null Het
Dcdc2a A T 13: 25,119,386 H300L probably benign Het
Dhdh C T 7: 45,488,706 V20M probably benign Het
Dhx34 T C 7: 16,210,537 Q584R probably benign Het
Dis3l2 A G 1: 87,047,092 Y701C probably damaging Het
Dmrt2 T C 19: 25,675,655 probably null Het
Dnah5 A G 15: 28,366,321 T2727A probably damaging Het
Dopey1 A G 9: 86,520,734 E1329G probably damaging Het
Evpl A G 11: 116,223,291 V1191A probably damaging Het
Fam198a A G 9: 121,978,352 T521A possibly damaging Het
Fgfr1op A G 17: 8,191,434 N342S possibly damaging Het
Fhl4 T C 10: 85,098,386 D177G probably damaging Het
Heg1 A G 16: 33,726,756 T662A possibly damaging Het
Ifih1 A G 2: 62,623,391 probably null Het
Il13 T C 11: 53,632,518 R87G possibly damaging Het
Kcnc3 T A 7: 44,595,928 Y547* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,764,698 G860D probably benign Het
Lmo7 T C 14: 101,887,173 L356P probably damaging Het
Lmo7 A T 14: 101,896,559 K447I probably damaging Het
Lrp2bp A G 8: 46,011,958 H38R probably damaging Het
Magi3 G A 3: 104,015,022 P1460S probably damaging Het
Megf8 T A 7: 25,364,303 C2695S possibly damaging Het
Mrgprb2 T G 7: 48,551,970 S336R probably benign Het
Mrgprx2 C T 7: 48,482,964 M1I probably null Het
Mug2 T C 6: 122,081,599 L1320P probably damaging Het
Noxred1 A G 12: 87,227,064 S68P probably benign Het
Olfr504 T A 7: 108,565,672 Y41F probably damaging Het
Olfr561 T A 7: 102,775,332 H269Q probably benign Het
Os9 C T 10: 127,119,639 C123Y probably damaging Het
Ostf1 T A 19: 18,596,359 T42S probably benign Het
Pcnx T A 12: 81,995,110 M2172K probably benign Het
Pip4k2a A G 2: 18,845,936 I360T probably damaging Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Plch2 A G 4: 154,998,886 S431P probably damaging Het
Prl8a6 A T 13: 27,433,007 C233* probably null Het
Prox1 G A 1: 190,161,456 T264I probably damaging Het
Prr5 A G 15: 84,702,766 N248S probably benign Het
Psip1 A C 4: 83,460,037 S407R probably damaging Het
Rab32 A T 10: 10,550,896 V102E probably damaging Het
Rap1gap2 T G 11: 74,388,854 K687Q possibly damaging Het
Rbak A T 5: 143,173,414 V628E probably damaging Het
Rnf148 T C 6: 23,654,793 E68G possibly damaging Het
Rnf212 A T 5: 108,749,442 S3T probably damaging Het
Rrad T G 8: 104,628,627 I250L probably benign Het
Sall4 T C 2: 168,755,705 H405R probably damaging Het
Scn9a T C 2: 66,483,678 R1888G probably damaging Het
Setd5 G T 6: 113,119,437 E535* probably null Het
Slc20a1 C T 2: 129,199,891 S58L probably damaging Het
Slc31a1 A G 4: 62,385,604 probably benign Het
Slc38a11 G T 2: 65,316,865 Q423K probably benign Het
Snrpd1 A T 18: 10,626,846 T38S possibly damaging Het
Taar4 A G 10: 23,960,882 D130G probably damaging Het
Tfb2m C T 1: 179,531,304 R338H probably benign Het
Tm2d2 A G 8: 25,022,726 I197V possibly damaging Het
Tmem132a C T 19: 10,858,991 G725D probably damaging Het
Tmem67 T C 4: 12,089,317 T38A probably benign Het
Tmprss15 A T 16: 78,968,267 S816T probably benign Het
Tnfrsf11a A G 1: 105,826,992 E263G probably damaging Het
Tnfrsf17 C T 16: 11,315,327 L90F probably benign Het
Tpr A G 1: 150,402,273 K117E possibly damaging Het
Trim43a C T 9: 88,584,336 Q5* probably null Het
Ubn1 A T 16: 5,073,071 D498V probably damaging Het
Vipr1 T A 9: 121,658,049 C63S probably damaging Het
Vmn1r237 T A 17: 21,314,670 H218Q possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r95 T C 17: 18,451,582 V527A probably benign Het
Vmn2r97 A T 17: 18,914,472 T51S probably benign Het
Vwa8 G A 14: 78,947,189 V376I probably benign Het
Wdfy4 T A 14: 33,080,775 T1838S probably benign Het
Zcwpw1 A T 5: 137,796,683 E47V probably benign Het
Zeb2 T C 2: 45,002,647 E130G possibly damaging Het
Zfp111 A G 7: 24,199,143 Y348H probably damaging Het
Zfp53 T C 17: 21,509,009 S435P probably damaging Het
Other mutations in Parg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Parg APN 14 32296185 splice site probably benign
IGL01879:Parg APN 14 32271622 splice site probably benign
IGL02391:Parg APN 14 32262681 splice site probably null
IGL02451:Parg APN 14 32242229 missense probably damaging 1.00
IGL02598:Parg APN 14 32214324 missense probably damaging 1.00
IGL02899:Parg APN 14 32238574 missense probably damaging 1.00
R0112:Parg UTSW 14 32202433 missense probably damaging 1.00
R0167:Parg UTSW 14 32217736 critical splice donor site probably null
R0834:Parg UTSW 14 32214554 splice site probably benign
R1140:Parg UTSW 14 32296243 missense probably benign 0.01
R1480:Parg UTSW 14 32209628 nonsense probably null
R1611:Parg UTSW 14 32238570 missense probably damaging 1.00
R1912:Parg UTSW 14 32210540 missense probably damaging 0.99
R1916:Parg UTSW 14 32208227 splice site probably benign
R1983:Parg UTSW 14 32217696 missense probably damaging 1.00
R2007:Parg UTSW 14 32210574 missense possibly damaging 0.87
R2275:Parg UTSW 14 32295238 missense probably damaging 0.98
R2942:Parg UTSW 14 32209337 missense probably damaging 1.00
R4206:Parg UTSW 14 32254536 missense probably benign 0.07
R4482:Parg UTSW 14 32262774 missense probably damaging 1.00
R4512:Parg UTSW 14 32262736 missense probably damaging 1.00
R4519:Parg UTSW 14 32209635 missense probably damaging 1.00
R4611:Parg UTSW 14 32274864 missense probably damaging 1.00
R4831:Parg UTSW 14 32202451 missense probably benign 0.00
R4876:Parg UTSW 14 32271668 missense probably damaging 0.98
R5298:Parg UTSW 14 32202253 missense probably damaging 1.00
R5606:Parg UTSW 14 32262736 missense probably damaging 1.00
R5782:Parg UTSW 14 32274905 nonsense probably null
R5878:Parg UTSW 14 32217662 missense possibly damaging 0.85
R6373:Parg UTSW 14 32209497 unclassified probably null
R6436:Parg UTSW 14 32271677 missense probably damaging 1.00
R6530:Parg UTSW 14 32209199 missense probably damaging 1.00
R7285:Parg UTSW 14 32210508 missense probably damaging 0.98
R7348:Parg UTSW 14 32250079 missense possibly damaging 0.82
R7455:Parg UTSW 14 32209475 missense probably benign
R7780:Parg UTSW 14 32208801 missense possibly damaging 0.94
R7887:Parg UTSW 14 32217662 missense possibly damaging 0.85
R7970:Parg UTSW 14 32217662 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCGCTCTCAAGTCATACTGTTGTACTG -3'
(R):5'- ACCTGATGCTGAACAGAATGCACC -3'

Sequencing Primer
(F):5'- actgctgatcctcctctcc -3'
(R):5'- ATGCACCTGAGAAGGCCC -3'
Posted On2013-06-12