Incidental Mutation 'R5981:Panx3'
ID481416
Institutional Source Beutler Lab
Gene Symbol Panx3
Ensembl Gene ENSMUSG00000011118
Gene Namepannexin 3
Synonyms4833413G11Rik
MMRRC Submission 043250-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5981 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37659902-37669235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37668881 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 59 (S59P)
Ref Sequence ENSEMBL: ENSMUSP00000011262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011262] [ENSMUST00000142228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011262
AA Change: S59P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011262
Gene: ENSMUSG00000011118
AA Change: S59P

DomainStartEndE-ValueType
Pfam:Innexin 33 270 1.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142228
AA Change: S59P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215047
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are known to be the structural components of gap junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against surgically induced osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccr3 G A 9: 124,028,783 G52S probably damaging Het
Cep192 T C 18: 67,860,590 L1992P probably damaging Het
Cnot1 T C 8: 95,788,665 K23E probably damaging Het
Col12a1 G A 9: 79,678,506 R1224C probably damaging Het
Cox7c A T 13: 86,046,661 S5R possibly damaging Het
Eps8 A G 6: 137,482,210 V765A probably damaging Het
Frg1 T C 8: 41,410,270 D104G possibly damaging Het
Gm11032 T C 11: 4,621,697 V34A probably benign Het
Gm5538 T C 3: 59,751,878 Y251H probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Hivep1 C T 13: 42,160,188 T1968I probably damaging Het
Mctp1 A G 13: 76,757,110 D444G probably damaging Het
Ms4a1 T C 19: 11,251,816 E242G probably benign Het
Mx1 T C 16: 97,454,205 D216G probably damaging Het
Pcdhgb1 A G 18: 37,681,854 D466G probably damaging Het
Plg T C 17: 12,378,718 probably null Het
Prpf4b T C 13: 34,886,710 S427P probably benign Het
Rbm44 T C 1: 91,152,689 S166P possibly damaging Het
Recql A G 6: 142,372,878 L213P probably damaging Het
Rwdd1 A G 10: 34,009,085 Y60H probably damaging Het
Sult1b1 A C 5: 87,534,957 I43R probably damaging Het
Trak2 A T 1: 58,908,690 V597E probably benign Het
Usp17lb T A 7: 104,841,187 I177F probably damaging Het
Zfp410 A G 12: 84,331,640 E193G probably benign Het
Other mutations in Panx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Panx3 APN 9 37661471 missense probably damaging 1.00
IGL01371:Panx3 APN 9 37661475 missense probably benign 0.03
IGL01458:Panx3 APN 9 37661147 missense probably damaging 0.99
IGL01637:Panx3 APN 9 37664056 missense probably damaging 0.98
R1693:Panx3 UTSW 9 37668907 missense possibly damaging 0.64
R1693:Panx3 UTSW 9 37668946 missense possibly damaging 0.88
R1708:Panx3 UTSW 9 37661391 missense probably benign 0.00
R1818:Panx3 UTSW 9 37664026 missense probably benign 0.04
R2142:Panx3 UTSW 9 37666673 missense probably damaging 1.00
R5386:Panx3 UTSW 9 37669024 missense probably damaging 0.99
R6273:Panx3 UTSW 9 37667429 missense probably benign 0.01
R6429:Panx3 UTSW 9 37661165 missense probably damaging 1.00
R6768:Panx3 UTSW 9 37664026 missense probably benign 0.04
R7082:Panx3 UTSW 9 37666617 missense probably benign 0.25
R7165:Panx3 UTSW 9 37664085 missense probably damaging 1.00
R7173:Panx3 UTSW 9 37661300 missense probably damaging 0.99
R7494:Panx3 UTSW 9 37661312 missense probably damaging 1.00
R7629:Panx3 UTSW 9 37661444 missense possibly damaging 0.83
R7650:Panx3 UTSW 9 37661405 missense probably damaging 0.97
R8032:Panx3 UTSW 9 37661670 missense probably damaging 1.00
R8383:Panx3 UTSW 9 37666753 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGGTTTGGTGCTTCTGCTC -3'
(R):5'- TCGCTTAGGGTAGCATTTTCCTC -3'

Sequencing Primer
(F):5'- GCTCTTCTGATGTCCCATACTTACG -3'
(R):5'- TCAGCAGCATCATGTCGC -3'
Posted On2017-06-26