Incidental Mutation 'R5982:Babam2'
ID481442
Institutional Source Beutler Lab
Gene Symbol Babam2
Ensembl Gene ENSMUSG00000052139
Gene NameBRISC and BRCA1 A complex member 2
SynonymsBre, 6030405P19Rik, B830038C02Rik
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R5982 (G1)
Quality Score135.008
Status Validated
Chromosome5
Chromosomal Location31697684-32084962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31820620 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 139 (E139V)
Ref Sequence ENSEMBL: ENSMUSP00000071462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063813] [ENSMUST00000071531] [ENSMUST00000114507] [ENSMUST00000114515] [ENSMUST00000131995] [ENSMUST00000200705] [ENSMUST00000201352] [ENSMUST00000202293]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063813
AA Change: E185V

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069133
Gene: ENSMUSG00000052139
AA Change: E185V

DomainStartEndE-ValueType
Pfam:BRE 70 370 3.4e-133 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071531
AA Change: E139V

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071462
Gene: ENSMUSG00000052139
AA Change: E139V

DomainStartEndE-ValueType
Pfam:BRE 28 324 2.2e-204 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114507
AA Change: E84V

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110152
Gene: ENSMUSG00000052139
AA Change: E84V

DomainStartEndE-ValueType
Pfam:BRE 3 269 9.5e-182 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114515
AA Change: E148V

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110160
Gene: ENSMUSG00000052139
AA Change: E148V

DomainStartEndE-ValueType
Pfam:BRE 1 333 4.9e-235 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131995
AA Change: E10V

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128351
Gene: ENSMUSG00000052139
AA Change: E10V

DomainStartEndE-ValueType
Pfam:BRE 1 195 4.3e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200705
AA Change: E148V

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143964
Gene: ENSMUSG00000052139
AA Change: E148V

DomainStartEndE-ValueType
Pfam:BRE 8 204 1.6e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201202
Predicted Effect possibly damaging
Transcript: ENSMUST00000201352
AA Change: E148V

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144205
Gene: ENSMUSG00000052139
AA Change: E148V

DomainStartEndE-ValueType
Pfam:BRE 8 333 8.1e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202270
Predicted Effect probably benign
Transcript: ENSMUST00000202293
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an anti-apoptotic, death receptor-associated protein that interacts with tumor necrosis factor-receptor-1. The encoded protein acts as an adapter in several protein complexes, including the BRCA1-A complex and the BRISC complex. The BRCA1-A complex possesses ubiquitinase activity and targets sites of double strand DNA breaks, while the BRISC complex exhibits deubiquitinase activity and is involved in mitotic spindle assembly. This gene is upregulated in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. However, fibroblasts exhibit decreased proliferation and increased cellular replicative senescence in response to irradiation and hydrogen peroxide with impaired DNA damage repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Babam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Babam2 APN 5 32007307 missense probably damaging 1.00
IGL01815:Babam2 APN 5 31702098 missense possibly damaging 0.90
IGL02869:Babam2 APN 5 32004772 missense possibly damaging 0.92
IGL03091:Babam2 APN 5 31785678 splice site probably null
IGL03185:Babam2 APN 5 31702032 missense possibly damaging 0.60
R1817:Babam2 UTSW 5 32057546 missense probably damaging 0.99
R4012:Babam2 UTSW 5 32001438 missense probably damaging 1.00
R4257:Babam2 UTSW 5 31702070 missense possibly damaging 0.76
R4522:Babam2 UTSW 5 32007242 missense probably damaging 1.00
R4622:Babam2 UTSW 5 32007312 missense probably damaging 0.99
R4738:Babam2 UTSW 5 31901142 missense probably damaging 0.99
R4752:Babam2 UTSW 5 31702047 intron probably benign
R4927:Babam2 UTSW 5 31702064 missense probably benign 0.00
R4962:Babam2 UTSW 5 31785583 missense possibly damaging 0.75
R5374:Babam2 UTSW 5 32007230 splice site probably benign
R5375:Babam2 UTSW 5 31701863 missense possibly damaging 0.52
R5453:Babam2 UTSW 5 32007246 missense probably damaging 1.00
R5890:Babam2 UTSW 5 32064807 intron probably benign
R5915:Babam2 UTSW 5 31785611 missense probably damaging 1.00
R6271:Babam2 UTSW 5 32001362 missense probably damaging 1.00
R7268:Babam2 UTSW 5 31701853 missense probably damaging 1.00
R7352:Babam2 UTSW 5 32007250 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGGCTGCTCTGATAATGCAG -3'
(R):5'- TTATGAAAAGGCGCACACAC -3'

Sequencing Primer
(F):5'- TGAGGGATTTGCATGAAACTGC -3'
(R):5'- TTATGAAAAGGCGCACACACAGATC -3'
Posted On2017-06-26