Incidental Mutation 'R5982:Foxm1'
ID481448
Institutional Source Beutler Lab
Gene Symbol Foxm1
Ensembl Gene ENSMUSG00000001517
Gene Nameforkhead box M1
SynonymsWIN, Mpm2, Foxm1b, Trident, Fkh16, HFH-11B
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5982 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128362967-128376146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128371035 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 307 (T307A)
Ref Sequence ENSEMBL: ENSMUSP00000073041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073316] [ENSMUST00000100926] [ENSMUST00000112148] [ENSMUST00000130785] [ENSMUST00000203040] [ENSMUST00000204223]
Predicted Effect probably damaging
Transcript: ENSMUST00000073316
AA Change: T307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517
AA Change: T307A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100926
SMART Domains Protein: ENSMUSP00000098486
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 306 1.9e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112148
AA Change: T307A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107776
Gene: ENSMUSG00000001517
AA Change: T307A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 414 439 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
low complexity region 518 531 N/A INTRINSIC
low complexity region 670 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125456
Predicted Effect probably benign
Transcript: ENSMUST00000130785
SMART Domains Protein: ENSMUSP00000145112
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 223 3.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153423
Predicted Effect probably damaging
Transcript: ENSMUST00000203040
AA Change: T153A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145305
Gene: ENSMUSG00000001517
AA Change: T153A

DomainStartEndE-ValueType
FH 78 165 1.2e-44 SMART
low complexity region 276 301 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203258
AA Change: T141A
Predicted Effect probably benign
Transcript: ENSMUST00000204223
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele die in utero exhibiting reduced hepatoblast mitosis, impaired liver, bile duct and lung development, myocardial defects and ventricular hypoplasia. Most homozygotes for another null allele die perinatally with myocardialdefects and polyploidy in heart and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Foxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Foxm1 APN 6 128370967 missense possibly damaging 0.94
IGL01312:Foxm1 APN 6 128373374 missense probably damaging 0.97
IGL01317:Foxm1 APN 6 128367353 missense probably damaging 0.98
IGL01683:Foxm1 APN 6 128373488 missense probably benign 0.01
IGL01837:Foxm1 APN 6 128366204 unclassified probably benign
IGL02039:Foxm1 APN 6 128369360 missense probably damaging 1.00
IGL02490:Foxm1 APN 6 128373351 nonsense probably null
IGL02685:Foxm1 APN 6 128373107 missense possibly damaging 0.89
IGL03335:Foxm1 APN 6 128372568 missense possibly damaging 0.92
R0374:Foxm1 UTSW 6 128372603 missense probably damaging 1.00
R0625:Foxm1 UTSW 6 128373871 missense probably damaging 1.00
R1420:Foxm1 UTSW 6 128372921 missense possibly damaging 0.94
R1471:Foxm1 UTSW 6 128373874 missense probably damaging 1.00
R2013:Foxm1 UTSW 6 128375502 unclassified probably null
R4334:Foxm1 UTSW 6 128365967 missense probably damaging 1.00
R4753:Foxm1 UTSW 6 128372556 missense probably null 0.89
R4834:Foxm1 UTSW 6 128369447 missense probably damaging 1.00
R4997:Foxm1 UTSW 6 128365768 missense probably benign 0.06
R5657:Foxm1 UTSW 6 128373388 missense possibly damaging 0.95
R5666:Foxm1 UTSW 6 128373167 missense possibly damaging 0.69
R5763:Foxm1 UTSW 6 128366108 missense probably benign 0.06
R6164:Foxm1 UTSW 6 128373935 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGTAGTAGGAGATGCCCTGG -3'
(R):5'- TAGGGCAAGGACTGTCACTTG -3'

Sequencing Primer
(F):5'- TAGGAGATGCCCTGGCCTTTC -3'
(R):5'- CTGTTCAGGGCATTACGCAAG -3'
Posted On2017-06-26