Incidental Mutation 'R5982:Olfr639'
ID481455
Institutional Source Beutler Lab
Gene Symbol Olfr639
Ensembl Gene ENSMUSG00000066263
Gene Nameolfactory receptor 639
SynonymsMOR12-1, GA_x6K02T2PBJ9-6747143-6746193
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5982 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104006231-104017303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104011910 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 264 (H264P)
Ref Sequence ENSEMBL: ENSMUSP00000149743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106862] [ENSMUST00000138055] [ENSMUST00000215653]
Predicted Effect probably damaging
Transcript: ENSMUST00000106862
AA Change: H264P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102475
Gene: ENSMUSG00000066263
AA Change: H264P

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.4e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 173 3.6e-9 PFAM
Pfam:7tm_1 43 294 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215653
AA Change: H264P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Olfr639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr639 APN 7 104012114 missense probably damaging 1.00
IGL01547:Olfr639 APN 7 104012660 missense probably benign 0.43
IGL02173:Olfr639 APN 7 104011830 missense probably damaging 1.00
IGL02707:Olfr639 APN 7 104012402 missense probably damaging 1.00
IGL03124:Olfr639 APN 7 104011794 missense probably benign
R0004:Olfr639 UTSW 7 104012431 missense probably benign 0.02
R0086:Olfr639 UTSW 7 104012054 missense probably benign 0.23
R0370:Olfr639 UTSW 7 104012059 missense probably damaging 0.99
R0599:Olfr639 UTSW 7 104012188 nonsense probably null
R1351:Olfr639 UTSW 7 104012316 missense possibly damaging 0.81
R1604:Olfr639 UTSW 7 104011955 missense probably damaging 1.00
R2314:Olfr639 UTSW 7 104012229 missense probably benign 0.09
R2656:Olfr639 UTSW 7 104011865 missense probably damaging 0.96
R4594:Olfr639 UTSW 7 104012417 missense probably benign 0.01
R4774:Olfr639 UTSW 7 104012588 missense probably benign 0.00
R4945:Olfr639 UTSW 7 104012378 missense possibly damaging 0.85
R4968:Olfr639 UTSW 7 104012570 missense probably damaging 1.00
R4981:Olfr639 UTSW 7 104012105 missense probably damaging 0.97
R5072:Olfr639 UTSW 7 104012118 missense probably damaging 0.97
R6303:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6304:Olfr639 UTSW 7 104012031 missense probably damaging 1.00
R6332:Olfr639 UTSW 7 104011773 missense probably benign 0.00
R7107:Olfr639 UTSW 7 104012282 missense probably benign 0.16
R7152:Olfr639 UTSW 7 104012019 missense probably benign
R7456:Olfr639 UTSW 7 104011838 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCAAGAATAATCCCTGCTCTCTG -3'
(R):5'- GGTTGAATAGCATCCTGGGG -3'

Sequencing Primer
(F):5'- AGAATAATCCCTGCTCTCTGAGTGTG -3'
(R):5'- AATAGCATCCTGGGGTTGGCC -3'
Posted On2017-06-26