Mutagenetix > Incidental Mutations

Incidental Mutation 'R5982:Dnajc13'

481464

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

044163-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R5982 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 104184615 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1380 (T1380K)

Ref Sequence

ENSEMBL: ENSMUSP00000139804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035170
AA Change: T1375K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: T1375K

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185503

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186788
AA Change: T1380K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: T1380K

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191199

Meta Mutation Damage Score

0.1715

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,597	E931D	possibly damaging	Het
Aebp1	C	T	11: 5,867,911	T62I	possibly damaging	Het
Babam2	A	T	5: 31,820,620	E139V	possibly damaging	Het
Bclaf1	C	T	10: 20,323,063	R67*	probably null	Het
Bcr	C	A	10: 75,176,416	T51K	probably benign	Het
Best3	T	A	10: 117,004,417	C251S	probably damaging	Het
Birc6	A	G	17: 74,648,158	M3457V	probably benign	Het
C87436	C	A	6: 86,445,975	T177K	possibly damaging	Het
Cabin1	T	A	10: 75,725,560	T1036S	probably benign	Het
Catsperg2	C	A	7: 29,713,017	V383L	possibly damaging	Het
Ccdc182	C	T	11: 88,294,339	Q82*	probably null	Het
Ccl9	T	C	11: 83,575,874	T76A	probably damaging	Het
Cdc16	G	T	8: 13,781,399	C544F	possibly damaging	Het
Cdh18	A	C	15: 23,474,216	D724A	possibly damaging	Het
Cdip1	G	A	16: 4,770,082	P6S	probably damaging	Het
Col12a1	A	G	9: 79,630,560	V2542A	probably damaging	Het
Dsg4	T	A	18: 20,465,169	S715T	possibly damaging	Het
Dync2h1	G	T	9: 6,955,986	T4132K	probably benign	Het
Egfem1	A	T	3: 29,657,270		probably null	Het
Etl4	G	T	2: 20,781,015	V716L	probably damaging	Het
Exoc3l2	A	G	7: 19,480,032	E461G	unknown	Het
Fam135b	A	G	15: 71,448,669		probably null	Het
Flrt3	G	T	2: 140,660,916	P264Q	possibly damaging	Het
Fmn2	G	C	1: 174,502,453	E136D	unknown	Het
Fosl2	A	G	5: 32,146,873	I51V	probably benign	Het
Foxm1	A	G	6: 128,371,035	T307A	probably damaging	Het
Garem1	T	C	18: 21,148,351	D316G	possibly damaging	Het
Gm13088	C	A	4: 143,654,464	V330F	probably damaging	Het
Gm14403	A	T	2: 177,508,552	H97L	probably damaging	Het
Gm5616	A	G	9: 48,450,590		noncoding transcript	Het
Hkdc1	T	C	10: 62,393,810	D696G	probably benign	Het
Igkv1-88	C	A	6: 68,862,448	W60L	probably damaging	Het
Iqgap3	G	A	3: 88,091,592	W333*	probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnk3	G	T	5: 30,622,670	V355L	probably benign	Het
Kmt5c	A	C	7: 4,746,791	K436T	probably damaging	Het
Lynx1	T	C	15: 74,751,415	Y56C	possibly damaging	Het
Lypd5	T	C	7: 24,353,037	S149P	probably damaging	Het
Map3k21	A	T	8: 125,911,430	N252Y	probably damaging	Het
Mgat2	T	C	12: 69,185,680	W343R	probably damaging	Het
Misp	T	G	10: 79,827,894	Y567*	probably null	Het
Mrgprb1	A	T	7: 48,447,820	S115T	probably benign	Het
Muc16	A	C	9: 18,647,146	I2617R	unknown	Het
Myo19	T	A	11: 84,899,400	V394E	probably damaging	Het
Myo9b	T	A	8: 71,348,396	L1065Q	probably benign	Het
Nap1l1	A	G	10: 111,495,368	D405G	possibly damaging	Het
Napb	A	T	2: 148,700,491		probably null	Het
Nbas	A	G	12: 13,393,430	Y1162C	probably benign	Het
Nfam1	A	T	15: 83,033,124	L36Q	probably damaging	Het
Nrros	T	C	16: 32,144,593	D202G	probably damaging	Het
Olfr1355	T	G	10: 78,879,953	Y260*	probably null	Het
Olfr639	T	G	7: 104,011,910	H264P	probably damaging	Het
Osgin2	T	C	4: 15,998,908	E238G	probably benign	Het
Papss2	A	G	19: 32,639,236	T221A	probably benign	Het
Pcdhga12	A	C	18: 37,768,031	K639Q	probably damaging	Het
Pkhd1l1	T	A	15: 44,489,504		probably null	Het
Pmepa1	A	G	2: 173,234,312	S83P	possibly damaging	Het
Pnp	G	A	14: 50,950,543	V118M	probably damaging	Het
Ppat	T	C	5: 76,915,265	T500A	probably benign	Het
Rab11fip4	A	G	11: 79,690,775	N532S	probably benign	Het
Rbm25	A	G	12: 83,671,951	D499G	probably damaging	Het
Rnf139	A	G	15: 58,898,838	I237M	possibly damaging	Het
Rrp15	C	T	1: 186,739,755	S85N	possibly damaging	Het
Sidt1	T	C	16: 44,261,708	Y568C	probably damaging	Het
Slirp	A	G	12: 87,444,014	T29A	probably damaging	Het
Sltm	G	C	9: 70,586,804	E828Q	probably damaging	Het
Spindoc	A	G	19: 7,374,595	I129T	probably damaging	Het
Spire1	T	A	18: 67,497,316		probably null	Het
Styx	A	G	14: 45,368,452	T138A	probably benign	Het
Sv2c	A	T	13: 95,976,063	L642*	probably null	Het
Taf7	T	C	18: 37,643,445	E23G	probably damaging	Het
Tcp10a	A	T	17: 7,345,026	T406S	possibly damaging	Het
Tnrc6b	T	A	15: 80,880,816	S840T	probably benign	Het
Tns3	A	G	11: 8,492,245	I706T	probably damaging	Het
Tpsab1	A	G	17: 25,345,372	V36A	probably benign	Het
Trafd1	T	A	5: 121,373,279	D492V	probably damaging	Het
Trp53	A	G	11: 69,587,418	E51G	probably benign	Het
Vdr	C	T	15: 97,857,596	A349T	probably benign	Het
Vmn2r59	T	C	7: 42,046,067	D307G	probably benign	Het
Zfp365	C	A	10: 67,897,607	V252F	probably damaging	Het
Zfp830	T	A	11: 82,764,977	N202K	probably benign	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAACAACTGCTTTCCTGATCC -3'
(R):5'- ACCAGCTAGATGGCAATGGG -3'

Sequencing Primer
(F):5'- AACTGCTTTCCTGATCCCAAAC -3'
(R):5'- CTAGATGGCAATGGGAATGAATTC -3'

Posted On

2017-06-26