Incidental Mutation 'R5982:Zfp365'
ID481467
Institutional Source Beutler Lab
Gene Symbol Zfp365
Ensembl Gene ENSMUSG00000037855
Gene Namezinc finger protein 365
SynonymsSu48, DBZ
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5982 (G1)
Quality Score215.009
Status Validated
Chromosome10
Chromosomal Location67886103-67912662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67897607 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 252 (V252F)
Ref Sequence ENSEMBL: ENSMUSP00000067197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064656]
Predicted Effect probably damaging
Transcript: ENSMUST00000064656
AA Change: V252F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067197
Gene: ENSMUSG00000037855
AA Change: V252F

DomainStartEndE-ValueType
ZnF_C2H2 26 51 4.05e-1 SMART
coiled coil region 170 298 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138543
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes several isoforms which have different expression patterns and functions. Mutation in this gene is associated with uric acid nephrolithiasis (UAN). Alternatively spliced variants, encoding distinct proteins, have been identified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal cortical basket cells in the somatosensory cortices, delayed myelination in the corpus callosum during the early postnatal period, and an increase in immature oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Zfp365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp365 APN 10 67909354 missense probably damaging 1.00
IGL03257:Zfp365 APN 10 67889038 missense possibly damaging 0.76
ANU18:Zfp365 UTSW 10 67909354 missense probably damaging 1.00
R0482:Zfp365 UTSW 10 67897606 missense probably damaging 1.00
R1800:Zfp365 UTSW 10 67888942 missense probably damaging 0.98
R1986:Zfp365 UTSW 10 67909856 missense probably damaging 1.00
R4279:Zfp365 UTSW 10 67897601 missense probably benign 0.44
R4475:Zfp365 UTSW 10 67888920 missense possibly damaging 0.87
R4951:Zfp365 UTSW 10 67889991 critical splice acceptor site probably null
R5599:Zfp365 UTSW 10 67909367 missense probably damaging 1.00
R5682:Zfp365 UTSW 10 67909807 missense probably damaging 1.00
R5697:Zfp365 UTSW 10 67909640 missense probably benign 0.01
R5837:Zfp365 UTSW 10 67889040 missense probably damaging 1.00
R6974:Zfp365 UTSW 10 67909764 missense probably damaging 1.00
R7043:Zfp365 UTSW 10 67909826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCACTAGTGTCACAGC -3'
(R):5'- ACCGGCTGTCACTTTGTCAC -3'

Sequencing Primer
(F):5'- TAGTGTCACAGCTAAAACCGG -3'
(R):5'- TGCTGTTAACTCCTGACAGAAC -3'
Posted On2017-06-26