Incidental Mutation 'R5982:Cabin1'
ID481469
Institutional Source Beutler Lab
Gene Symbol Cabin1
Ensembl Gene ENSMUSG00000020196
Gene Namecalcineurin binding protein 1
SynonymsCain, Ppp3in, A330070M20Rik
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5982 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75646112-75764341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75725560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1036 (T1036S)
Ref Sequence ENSEMBL: ENSMUSP00000001712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001712] [ENSMUST00000218790] [ENSMUST00000218878]
Predicted Effect probably benign
Transcript: ENSMUST00000001712
AA Change: T1036S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: T1036S

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
TPR 90 123 4.15e-2 SMART
TPR 124 157 5.69e0 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
TPR 615 648 9.7e0 SMART
low complexity region 740 750 N/A INTRINSIC
low complexity region 882 892 N/A INTRINSIC
TPR 1055 1088 6.92e1 SMART
low complexity region 1327 1349 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1778 1790 N/A INTRINSIC
low complexity region 1791 1803 N/A INTRINSIC
low complexity region 1810 1831 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Pfam:MEF2_binding 2123 2157 5.7e-26 PFAM
low complexity region 2165 2183 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217810
AA Change: T209S
Predicted Effect probably benign
Transcript: ENSMUST00000218790
Predicted Effect probably benign
Transcript: ENSMUST00000218878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220009
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Cabin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cabin1 APN 10 75725586 missense possibly damaging 0.58
IGL01457:Cabin1 APN 10 75742429 missense probably damaging 0.96
IGL02217:Cabin1 APN 10 75700047 missense possibly damaging 0.95
IGL02649:Cabin1 APN 10 75737418 missense probably damaging 1.00
IGL02737:Cabin1 APN 10 75713585 missense probably benign 0.09
IGL02792:Cabin1 APN 10 75746739 missense probably damaging 1.00
IGL03047:Cabin1 APN 10 75700100 splice site probably benign
IGL03106:Cabin1 APN 10 75733628 missense probably benign 0.01
IGL03276:Cabin1 APN 10 75732413 missense probably damaging 1.00
R0335:Cabin1 UTSW 10 75657049 missense probably damaging 1.00
R0557:Cabin1 UTSW 10 75726917 missense probably damaging 1.00
R0578:Cabin1 UTSW 10 75713610 missense probably damaging 0.96
R0588:Cabin1 UTSW 10 75745337 missense possibly damaging 0.71
R1115:Cabin1 UTSW 10 75717677 missense possibly damaging 0.70
R1120:Cabin1 UTSW 10 75725716 missense probably damaging 1.00
R1439:Cabin1 UTSW 10 75656806 missense probably damaging 1.00
R1471:Cabin1 UTSW 10 75694792 missense probably damaging 1.00
R1794:Cabin1 UTSW 10 75725745 missense possibly damaging 0.52
R1844:Cabin1 UTSW 10 75743350 splice site probably null
R1959:Cabin1 UTSW 10 75735090 missense possibly damaging 0.92
R2008:Cabin1 UTSW 10 75734976 unclassified probably null
R2279:Cabin1 UTSW 10 75753461 missense probably benign
R3150:Cabin1 UTSW 10 75656911 missense probably damaging 1.00
R3929:Cabin1 UTSW 10 75751618 critical splice acceptor site probably null
R3945:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R3946:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R4206:Cabin1 UTSW 10 75754841 missense possibly damaging 0.69
R4812:Cabin1 UTSW 10 75646594 missense possibly damaging 0.93
R4944:Cabin1 UTSW 10 75721363 missense probably damaging 1.00
R4944:Cabin1 UTSW 10 75739421 missense probably damaging 0.99
R5078:Cabin1 UTSW 10 75721478 missense probably damaging 1.00
R5082:Cabin1 UTSW 10 75738330 missense probably damaging 0.99
R5319:Cabin1 UTSW 10 75725715 missense probably damaging 1.00
R5481:Cabin1 UTSW 10 75735066 missense probably benign 0.29
R5504:Cabin1 UTSW 10 75653009 missense probably benign 0.00
R5710:Cabin1 UTSW 10 75647018 missense probably benign 0.00
R5908:Cabin1 UTSW 10 75721532 missense probably damaging 1.00
R5975:Cabin1 UTSW 10 75657839 missense probably damaging 1.00
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6114:Cabin1 UTSW 10 75747971 missense probably benign 0.00
R6285:Cabin1 UTSW 10 75684323 missense probably damaging 1.00
R6341:Cabin1 UTSW 10 75658739 missense probably damaging 0.98
R6361:Cabin1 UTSW 10 75726865 missense possibly damaging 0.91
R6395:Cabin1 UTSW 10 75746742 missense probably benign 0.10
R6422:Cabin1 UTSW 10 75656792 missense probably damaging 1.00
R6575:Cabin1 UTSW 10 75725701 missense possibly damaging 0.90
R6763:Cabin1 UTSW 10 75746730 missense probably damaging 0.99
R6845:Cabin1 UTSW 10 75721508 missense probably damaging 1.00
R6936:Cabin1 UTSW 10 75715758 splice site probably null
R7050:Cabin1 UTSW 10 75713542 missense probably damaging 1.00
R7055:Cabin1 UTSW 10 75743283 missense probably benign 0.04
R7101:Cabin1 UTSW 10 75751567 missense probably benign
R7138:Cabin1 UTSW 10 75745353 missense probably damaging 0.98
R7173:Cabin1 UTSW 10 75746562 missense probably benign 0.00
R7265:Cabin1 UTSW 10 75721423 missense
R7284:Cabin1 UTSW 10 75694834 missense
R7472:Cabin1 UTSW 10 75658647 missense probably damaging 1.00
R7571:Cabin1 UTSW 10 75646666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATGGTAGTCAGCCAGG -3'
(R):5'- GGATCTTATATGGGAGGATGCC -3'

Sequencing Primer
(F):5'- TCATTCAGCACGGGAGGG -3'
(R):5'- AGGATGCCCTGTTTATGTTTGAG -3'
Posted On2017-06-26