Incidental Mutation 'R0514:Prr5'
ID48147
Institutional Source Beutler Lab
Gene Symbol Prr5
Ensembl Gene ENSMUSG00000036106
Gene Nameproline rich 5 (renal)
SynonymsC030017C09Rik, Protor-1
MMRRC Submission 038708-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0514 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location84669620-84703673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84702766 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 248 (N248S)
Ref Sequence ENSEMBL: ENSMUSP00000066396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065499] [ENSMUST00000171460]
Predicted Effect probably benign
Transcript: ENSMUST00000065499
AA Change: N248S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066396
Gene: ENSMUSG00000036106
AA Change: N248S

DomainStartEndE-ValueType
Pfam:HbrB 38 144 6.9e-17 PFAM
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171460
AA Change: N239S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127890
Gene: ENSMUSG00000036106
AA Change: N239S

DomainStartEndE-ValueType
Pfam:HbrB 27 159 1.3e-36 PFAM
low complexity region 324 335 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,319,978 Y154F probably damaging Het
Acsl6 A T 11: 54,350,580 D579V probably damaging Het
Adamts18 C T 8: 113,738,769 probably null Het
Adamts20 A T 15: 94,270,376 V1882D probably damaging Het
Add3 A T 19: 53,236,843 K465* probably null Het
Ago1 T G 4: 126,439,595 I524L probably benign Het
Akr1c18 A G 13: 4,137,191 M208T probably benign Het
Anapc1 C A 2: 128,632,655 L1413F probably damaging Het
Arid4b A T 13: 14,184,317 D646V probably damaging Het
Arnt2 T C 7: 84,304,859 E261G probably benign Het
Bccip C T 7: 133,719,130 T211I possibly damaging Het
Bsn T C 9: 108,125,782 S475G probably benign Het
Cdh26 G A 2: 178,466,828 probably null Het
Ceacam2 A G 7: 25,520,931 F414S probably benign Het
Cfb T C 17: 34,860,898 R172G probably damaging Het
Cntnap5b A C 1: 99,772,786 T8P probably benign Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crtc1 A T 8: 70,402,429 probably null Het
Dcdc2a A T 13: 25,119,386 H300L probably benign Het
Dhdh C T 7: 45,488,706 V20M probably benign Het
Dhx34 T C 7: 16,210,537 Q584R probably benign Het
Dis3l2 A G 1: 87,047,092 Y701C probably damaging Het
Dmrt2 T C 19: 25,675,655 probably null Het
Dnah5 A G 15: 28,366,321 T2727A probably damaging Het
Dopey1 A G 9: 86,520,734 E1329G probably damaging Het
Evpl A G 11: 116,223,291 V1191A probably damaging Het
Fam198a A G 9: 121,978,352 T521A possibly damaging Het
Fgfr1op A G 17: 8,191,434 N342S possibly damaging Het
Fhl4 T C 10: 85,098,386 D177G probably damaging Het
Heg1 A G 16: 33,726,756 T662A possibly damaging Het
Ifih1 A G 2: 62,623,391 probably null Het
Il13 T C 11: 53,632,518 R87G possibly damaging Het
Kcnc3 T A 7: 44,595,928 Y547* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,764,698 G860D probably benign Het
Lmo7 T C 14: 101,887,173 L356P probably damaging Het
Lmo7 A T 14: 101,896,559 K447I probably damaging Het
Lrp2bp A G 8: 46,011,958 H38R probably damaging Het
Magi3 G A 3: 104,015,022 P1460S probably damaging Het
Megf8 T A 7: 25,364,303 C2695S possibly damaging Het
Mrgprb2 T G 7: 48,551,970 S336R probably benign Het
Mrgprx2 C T 7: 48,482,964 M1I probably null Het
Mug2 T C 6: 122,081,599 L1320P probably damaging Het
Noxred1 A G 12: 87,227,064 S68P probably benign Het
Olfr504 T A 7: 108,565,672 Y41F probably damaging Het
Olfr561 T A 7: 102,775,332 H269Q probably benign Het
Os9 C T 10: 127,119,639 C123Y probably damaging Het
Ostf1 T A 19: 18,596,359 T42S probably benign Het
Parg C A 14: 32,254,560 T186K possibly damaging Het
Pcnx T A 12: 81,995,110 M2172K probably benign Het
Pip4k2a A G 2: 18,845,936 I360T probably damaging Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Plch2 A G 4: 154,998,886 S431P probably damaging Het
Prl8a6 A T 13: 27,433,007 C233* probably null Het
Prox1 G A 1: 190,161,456 T264I probably damaging Het
Psip1 A C 4: 83,460,037 S407R probably damaging Het
Rab32 A T 10: 10,550,896 V102E probably damaging Het
Rap1gap2 T G 11: 74,388,854 K687Q possibly damaging Het
Rbak A T 5: 143,173,414 V628E probably damaging Het
Rnf148 T C 6: 23,654,793 E68G possibly damaging Het
Rnf212 A T 5: 108,749,442 S3T probably damaging Het
Rrad T G 8: 104,628,627 I250L probably benign Het
Sall4 T C 2: 168,755,705 H405R probably damaging Het
Scn9a T C 2: 66,483,678 R1888G probably damaging Het
Setd5 G T 6: 113,119,437 E535* probably null Het
Slc20a1 C T 2: 129,199,891 S58L probably damaging Het
Slc31a1 A G 4: 62,385,604 probably benign Het
Slc38a11 G T 2: 65,316,865 Q423K probably benign Het
Snrpd1 A T 18: 10,626,846 T38S possibly damaging Het
Taar4 A G 10: 23,960,882 D130G probably damaging Het
Tfb2m C T 1: 179,531,304 R338H probably benign Het
Tm2d2 A G 8: 25,022,726 I197V possibly damaging Het
Tmem132a C T 19: 10,858,991 G725D probably damaging Het
Tmem67 T C 4: 12,089,317 T38A probably benign Het
Tmprss15 A T 16: 78,968,267 S816T probably benign Het
Tnfrsf11a A G 1: 105,826,992 E263G probably damaging Het
Tnfrsf17 C T 16: 11,315,327 L90F probably benign Het
Tpr A G 1: 150,402,273 K117E possibly damaging Het
Trim43a C T 9: 88,584,336 Q5* probably null Het
Ubn1 A T 16: 5,073,071 D498V probably damaging Het
Vipr1 T A 9: 121,658,049 C63S probably damaging Het
Vmn1r237 T A 17: 21,314,670 H218Q possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r95 T C 17: 18,451,582 V527A probably benign Het
Vmn2r97 A T 17: 18,914,472 T51S probably benign Het
Vwa8 G A 14: 78,947,189 V376I probably benign Het
Wdfy4 T A 14: 33,080,775 T1838S probably benign Het
Zcwpw1 A T 5: 137,796,683 E47V probably benign Het
Zeb2 T C 2: 45,002,647 E130G possibly damaging Het
Zfp111 A G 7: 24,199,143 Y348H probably damaging Het
Zfp53 T C 17: 21,509,009 S435P probably damaging Het
Other mutations in Prr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prr5 APN 15 84699655 missense possibly damaging 0.47
IGL02656:Prr5 APN 15 84699136 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0389:Prr5 UTSW 15 84702951 missense probably benign 0.00
R1414:Prr5 UTSW 15 84699711 nonsense probably null
R2027:Prr5 UTSW 15 84701379 missense probably damaging 0.99
R2230:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2231:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2232:Prr5 UTSW 15 84702780 missense probably benign 0.15
R3498:Prr5 UTSW 15 84703144 missense probably benign 0.12
R3791:Prr5 UTSW 15 84681216 missense probably damaging 1.00
R3910:Prr5 UTSW 15 84703144 missense probably benign 0.12
R5514:Prr5 UTSW 15 84702895 missense probably benign 0.01
R5911:Prr5 UTSW 15 84701434 nonsense probably null
R6085:Prr5 UTSW 15 84687905 missense probably damaging 1.00
R6187:Prr5 UTSW 15 84693772 missense probably damaging 1.00
R6394:Prr5 UTSW 15 84699724 missense probably damaging 0.99
R6422:Prr5 UTSW 15 84693804 missense probably damaging 1.00
R6631:Prr5 UTSW 15 84702777 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGGTCATTCACAGGTCAGACAG -3'
(R):5'- TCAAAGTCAGACACACTGGAGCG -3'

Sequencing Primer
(F):5'- AAGTTCTCCAGCTAAGGCAG -3'
(R):5'- GATCTGGTCCACAAGAGTCTCTG -3'
Posted On2013-06-12