Mutagenetix > Incidental Mutations

Incidental Mutation 'R5982:Nap1l1'

481473

Institutional Source

Beutler Lab

Gene Symbol

Nap1l1

Ensembl Gene

ENSMUSG00000058799

Gene Name

nucleosome assembly protein 1-like 1

Synonyms

D10Ertd68e

MMRRC Submission

044163-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.421) question?

Stock #

R5982 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111473223-111498150 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111495368 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 405 (D405G)

Ref Sequence

ENSEMBL: ENSMUSP00000126850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]

Predicted Effect

probably benign
Transcript: ENSMUST00000065917
AA Change: D378G

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799
AA Change: D378G

Domain	Start	End	E-Value	Type
coiled coil region	6	31	N/A	INTRINSIC
Pfam:NAP	75	346	1.5e-96	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171797
AA Change: D405G

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799
AA Change: D405G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
coiled coil region	33	58	N/A	INTRINSIC
Pfam:NAP	103	372	9.6e-110	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217908
AA Change: D378G

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000218828
AA Change: D378G

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218982

Predicted Effect

probably benign
Transcript: ENSMUST00000219143

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219718

Predicted Effect

probably benign
Transcript: ENSMUST00000219961

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,597	E931D	possibly damaging	Het
Aebp1	C	T	11: 5,867,911	T62I	possibly damaging	Het
Babam2	A	T	5: 31,820,620	E139V	possibly damaging	Het
Bclaf1	C	T	10: 20,323,063	R67*	probably null	Het
Bcr	C	A	10: 75,176,416	T51K	probably benign	Het
Best3	T	A	10: 117,004,417	C251S	probably damaging	Het
Birc6	A	G	17: 74,648,158	M3457V	probably benign	Het
C87436	C	A	6: 86,445,975	T177K	possibly damaging	Het
Cabin1	T	A	10: 75,725,560	T1036S	probably benign	Het
Catsperg2	C	A	7: 29,713,017	V383L	possibly damaging	Het
Ccdc182	C	T	11: 88,294,339	Q82*	probably null	Het
Ccl9	T	C	11: 83,575,874	T76A	probably damaging	Het
Cdc16	G	T	8: 13,781,399	C544F	possibly damaging	Het
Cdh18	A	C	15: 23,474,216	D724A	possibly damaging	Het
Cdip1	G	A	16: 4,770,082	P6S	probably damaging	Het
Col12a1	A	G	9: 79,630,560	V2542A	probably damaging	Het
Dnajc13	G	T	9: 104,184,615	T1380K	possibly damaging	Het
Dsg4	T	A	18: 20,465,169	S715T	possibly damaging	Het
Dync2h1	G	T	9: 6,955,986	T4132K	probably benign	Het
Egfem1	A	T	3: 29,657,270		probably null	Het
Etl4	G	T	2: 20,781,015	V716L	probably damaging	Het
Exoc3l2	A	G	7: 19,480,032	E461G	unknown	Het
Fam135b	A	G	15: 71,448,669		probably null	Het
Flrt3	G	T	2: 140,660,916	P264Q	possibly damaging	Het
Fmn2	G	C	1: 174,502,453	E136D	unknown	Het
Fosl2	A	G	5: 32,146,873	I51V	probably benign	Het
Foxm1	A	G	6: 128,371,035	T307A	probably damaging	Het
Garem1	T	C	18: 21,148,351	D316G	possibly damaging	Het
Gm13088	C	A	4: 143,654,464	V330F	probably damaging	Het
Gm14403	A	T	2: 177,508,552	H97L	probably damaging	Het
Gm5616	A	G	9: 48,450,590		noncoding transcript	Het
Hkdc1	T	C	10: 62,393,810	D696G	probably benign	Het
Igkv1-88	C	A	6: 68,862,448	W60L	probably damaging	Het
Iqgap3	G	A	3: 88,091,592	W333*	probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnk3	G	T	5: 30,622,670	V355L	probably benign	Het
Kmt5c	A	C	7: 4,746,791	K436T	probably damaging	Het
Lynx1	T	C	15: 74,751,415	Y56C	possibly damaging	Het
Lypd5	T	C	7: 24,353,037	S149P	probably damaging	Het
Map3k21	A	T	8: 125,911,430	N252Y	probably damaging	Het
Mgat2	T	C	12: 69,185,680	W343R	probably damaging	Het
Misp	T	G	10: 79,827,894	Y567*	probably null	Het
Mrgprb1	A	T	7: 48,447,820	S115T	probably benign	Het
Muc16	A	C	9: 18,647,146	I2617R	unknown	Het
Myo19	T	A	11: 84,899,400	V394E	probably damaging	Het
Myo9b	T	A	8: 71,348,396	L1065Q	probably benign	Het
Napb	A	T	2: 148,700,491		probably null	Het
Nbas	A	G	12: 13,393,430	Y1162C	probably benign	Het
Nfam1	A	T	15: 83,033,124	L36Q	probably damaging	Het
Nrros	T	C	16: 32,144,593	D202G	probably damaging	Het
Olfr1355	T	G	10: 78,879,953	Y260*	probably null	Het
Olfr639	T	G	7: 104,011,910	H264P	probably damaging	Het
Osgin2	T	C	4: 15,998,908	E238G	probably benign	Het
Papss2	A	G	19: 32,639,236	T221A	probably benign	Het
Pcdhga12	A	C	18: 37,768,031	K639Q	probably damaging	Het
Pkhd1l1	T	A	15: 44,489,504		probably null	Het
Pmepa1	A	G	2: 173,234,312	S83P	possibly damaging	Het
Pnp	G	A	14: 50,950,543	V118M	probably damaging	Het
Ppat	T	C	5: 76,915,265	T500A	probably benign	Het
Rab11fip4	A	G	11: 79,690,775	N532S	probably benign	Het
Rbm25	A	G	12: 83,671,951	D499G	probably damaging	Het
Rnf139	A	G	15: 58,898,838	I237M	possibly damaging	Het
Rrp15	C	T	1: 186,739,755	S85N	possibly damaging	Het
Sidt1	T	C	16: 44,261,708	Y568C	probably damaging	Het
Slirp	A	G	12: 87,444,014	T29A	probably damaging	Het
Sltm	G	C	9: 70,586,804	E828Q	probably damaging	Het
Spindoc	A	G	19: 7,374,595	I129T	probably damaging	Het
Spire1	T	A	18: 67,497,316		probably null	Het
Styx	A	G	14: 45,368,452	T138A	probably benign	Het
Sv2c	A	T	13: 95,976,063	L642*	probably null	Het
Taf7	T	C	18: 37,643,445	E23G	probably damaging	Het
Tcp10a	A	T	17: 7,345,026	T406S	possibly damaging	Het
Tnrc6b	T	A	15: 80,880,816	S840T	probably benign	Het
Tns3	A	G	11: 8,492,245	I706T	probably damaging	Het
Tpsab1	A	G	17: 25,345,372	V36A	probably benign	Het
Trafd1	T	A	5: 121,373,279	D492V	probably damaging	Het
Trp53	A	G	11: 69,587,418	E51G	probably benign	Het
Vdr	C	T	15: 97,857,596	A349T	probably benign	Het
Vmn2r59	T	C	7: 42,046,067	D307G	probably benign	Het
Zfp365	C	A	10: 67,897,607	V252F	probably damaging	Het
Zfp830	T	A	11: 82,764,977	N202K	probably benign	Het

Other mutations in Nap1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Nap1l1	APN	10	111486675	missense	probably damaging	0.98
IGL01453:Nap1l1	APN	10	111492978	missense	probably benign	0.09
IGL01734:Nap1l1	APN	10	111492899	missense	probably benign	0.26
IGL01843:Nap1l1	APN	10	111492911	missense	possibly damaging	0.93
PIT1430001:Nap1l1	UTSW	10	111486736	missense	probably damaging	1.00
PIT4131001:Nap1l1	UTSW	10	111486722	missense	probably null
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0132:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0601:Nap1l1	UTSW	10	111490363	splice site	probably benign
R1576:Nap1l1	UTSW	10	111494820	missense	probably damaging	1.00
R1619:Nap1l1	UTSW	10	111493379	missense	possibly damaging	0.77
R1969:Nap1l1	UTSW	10	111491053	missense	probably benign	0.03
R2071:Nap1l1	UTSW	10	111492900	missense	possibly damaging	0.46
R2383:Nap1l1	UTSW	10	111493411	missense	probably damaging	1.00
R3836:Nap1l1	UTSW	10	111495322	splice site	probably null
R3837:Nap1l1	UTSW	10	111495322	splice site	probably null
R3838:Nap1l1	UTSW	10	111495322	splice site	probably null
R3839:Nap1l1	UTSW	10	111495322	splice site	probably null
R4084:Nap1l1	UTSW	10	111490077	missense	possibly damaging	0.92
R4609:Nap1l1	UTSW	10	111492880	nonsense	probably null
R4985:Nap1l1	UTSW	10	111490083	missense	probably benign	0.01
R5906:Nap1l1	UTSW	10	111491030	nonsense	probably null
R6522:Nap1l1	UTSW	10	111494223	missense	probably damaging	0.99
R6868:Nap1l1	UTSW	10	111494808	missense	probably damaging	1.00
R7134:Nap1l1	UTSW	10	111494794	critical splice acceptor site	probably null
R7202:Nap1l1	UTSW	10	111491103	missense	probably damaging	1.00
R7789:Nap1l1	UTSW	10	111490456	missense	probably benign	0.01
R7950:Nap1l1	UTSW	10	111492908	missense	probably damaging	1.00
R8404:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8502:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53

Predicted Primers

PCR Primer
(F):5'- AAAGCTGTCTGGATGTCTCAAG -3'
(R):5'- CCAGTGTTTTACAGCAAATGGTAG -3'

Sequencing Primer
(F):5'- CTCAAGTTGTGTTGGGAAATTTTTC -3'
(R):5'- GGAGAATCCAAAGTTCAAAGCATTTC -3'

Posted On

2017-06-26