Mutagenetix > Incidental Mutations

Incidental Mutation 'R5982:Vdr'

481497

Institutional Source

Beutler Lab

Gene Symbol

Vdr

Ensembl Gene

ENSMUSG00000022479

Gene Name

vitamin D (1,25-dihydroxyvitamin D3) receptor

Synonyms

Nr1i1

MMRRC Submission

044163-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5982 (G1)

Quality Score

154.008

Status

Validated

Chromosome

Chromosomal Location

97854425-97910630 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 97857596 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 349 (A349T)

Ref Sequence

ENSEMBL: ENSMUSP00000023119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023119]

Predicted Effect

probably benign
Transcript: ENSMUST00000023119
AA Change: A349T

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479
AA Change: A349T

Domain	Start	End	E-Value	Type
ZnF_C4	21	92	1.4e-34	SMART
low complexity region	102	114	N/A	INTRINSIC
low complexity region	173	182	N/A	INTRINSIC
HOLI	227	389	3.54e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139656

Meta Mutation Damage Score

0.2005

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,597	E931D	possibly damaging	Het
Aebp1	C	T	11: 5,867,911	T62I	possibly damaging	Het
Babam2	A	T	5: 31,820,620	E139V	possibly damaging	Het
Bclaf1	C	T	10: 20,323,063	R67*	probably null	Het
Bcr	C	A	10: 75,176,416	T51K	probably benign	Het
Best3	T	A	10: 117,004,417	C251S	probably damaging	Het
Birc6	A	G	17: 74,648,158	M3457V	probably benign	Het
C87436	C	A	6: 86,445,975	T177K	possibly damaging	Het
Cabin1	T	A	10: 75,725,560	T1036S	probably benign	Het
Catsperg2	C	A	7: 29,713,017	V383L	possibly damaging	Het
Ccdc182	C	T	11: 88,294,339	Q82*	probably null	Het
Ccl9	T	C	11: 83,575,874	T76A	probably damaging	Het
Cdc16	G	T	8: 13,781,399	C544F	possibly damaging	Het
Cdh18	A	C	15: 23,474,216	D724A	possibly damaging	Het
Cdip1	G	A	16: 4,770,082	P6S	probably damaging	Het
Col12a1	A	G	9: 79,630,560	V2542A	probably damaging	Het
Dnajc13	G	T	9: 104,184,615	T1380K	possibly damaging	Het
Dsg4	T	A	18: 20,465,169	S715T	possibly damaging	Het
Dync2h1	G	T	9: 6,955,986	T4132K	probably benign	Het
Egfem1	A	T	3: 29,657,270		probably null	Het
Etl4	G	T	2: 20,781,015	V716L	probably damaging	Het
Exoc3l2	A	G	7: 19,480,032	E461G	unknown	Het
Fam135b	A	G	15: 71,448,669		probably null	Het
Flrt3	G	T	2: 140,660,916	P264Q	possibly damaging	Het
Fmn2	G	C	1: 174,502,453	E136D	unknown	Het
Fosl2	A	G	5: 32,146,873	I51V	probably benign	Het
Foxm1	A	G	6: 128,371,035	T307A	probably damaging	Het
Garem1	T	C	18: 21,148,351	D316G	possibly damaging	Het
Gm13088	C	A	4: 143,654,464	V330F	probably damaging	Het
Gm14403	A	T	2: 177,508,552	H97L	probably damaging	Het
Gm5616	A	G	9: 48,450,590		noncoding transcript	Het
Hkdc1	T	C	10: 62,393,810	D696G	probably benign	Het
Igkv1-88	C	A	6: 68,862,448	W60L	probably damaging	Het
Iqgap3	G	A	3: 88,091,592	W333*	probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnk3	G	T	5: 30,622,670	V355L	probably benign	Het
Kmt5c	A	C	7: 4,746,791	K436T	probably damaging	Het
Lynx1	T	C	15: 74,751,415	Y56C	possibly damaging	Het
Lypd5	T	C	7: 24,353,037	S149P	probably damaging	Het
Map3k21	A	T	8: 125,911,430	N252Y	probably damaging	Het
Mgat2	T	C	12: 69,185,680	W343R	probably damaging	Het
Misp	T	G	10: 79,827,894	Y567*	probably null	Het
Mrgprb1	A	T	7: 48,447,820	S115T	probably benign	Het
Muc16	A	C	9: 18,647,146	I2617R	unknown	Het
Myo19	T	A	11: 84,899,400	V394E	probably damaging	Het
Myo9b	T	A	8: 71,348,396	L1065Q	probably benign	Het
Nap1l1	A	G	10: 111,495,368	D405G	possibly damaging	Het
Napb	A	T	2: 148,700,491		probably null	Het
Nbas	A	G	12: 13,393,430	Y1162C	probably benign	Het
Nfam1	A	T	15: 83,033,124	L36Q	probably damaging	Het
Nrros	T	C	16: 32,144,593	D202G	probably damaging	Het
Olfr1355	T	G	10: 78,879,953	Y260*	probably null	Het
Olfr639	T	G	7: 104,011,910	H264P	probably damaging	Het
Osgin2	T	C	4: 15,998,908	E238G	probably benign	Het
Papss2	A	G	19: 32,639,236	T221A	probably benign	Het
Pcdhga12	A	C	18: 37,768,031	K639Q	probably damaging	Het
Pkhd1l1	T	A	15: 44,489,504		probably null	Het
Pmepa1	A	G	2: 173,234,312	S83P	possibly damaging	Het
Pnp	G	A	14: 50,950,543	V118M	probably damaging	Het
Ppat	T	C	5: 76,915,265	T500A	probably benign	Het
Rab11fip4	A	G	11: 79,690,775	N532S	probably benign	Het
Rbm25	A	G	12: 83,671,951	D499G	probably damaging	Het
Rnf139	A	G	15: 58,898,838	I237M	possibly damaging	Het
Rrp15	C	T	1: 186,739,755	S85N	possibly damaging	Het
Sidt1	T	C	16: 44,261,708	Y568C	probably damaging	Het
Slirp	A	G	12: 87,444,014	T29A	probably damaging	Het
Sltm	G	C	9: 70,586,804	E828Q	probably damaging	Het
Spindoc	A	G	19: 7,374,595	I129T	probably damaging	Het
Spire1	T	A	18: 67,497,316		probably null	Het
Styx	A	G	14: 45,368,452	T138A	probably benign	Het
Sv2c	A	T	13: 95,976,063	L642*	probably null	Het
Taf7	T	C	18: 37,643,445	E23G	probably damaging	Het
Tcp10a	A	T	17: 7,345,026	T406S	possibly damaging	Het
Tnrc6b	T	A	15: 80,880,816	S840T	probably benign	Het
Tns3	A	G	11: 8,492,245	I706T	probably damaging	Het
Tpsab1	A	G	17: 25,345,372	V36A	probably benign	Het
Trafd1	T	A	5: 121,373,279	D492V	probably damaging	Het
Trp53	A	G	11: 69,587,418	E51G	probably benign	Het
Vmn2r59	T	C	7: 42,046,067	D307G	probably benign	Het
Zfp365	C	A	10: 67,897,607	V252F	probably damaging	Het
Zfp830	T	A	11: 82,764,977	N202K	probably benign	Het

Other mutations in Vdr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Vdr	APN	15	97884854	missense	probably damaging	1.00
IGL02813:Vdr	APN	15	97869681	missense	probably benign	0.45
yangshuo	UTSW	15	97859121	missense	probably damaging	1.00
R0400:Vdr	UTSW	15	97869351	missense	probably benign	0.00
R1102:Vdr	UTSW	15	97859121	missense	probably damaging	1.00
R1172:Vdr	UTSW	15	97869333	missense	probably benign	0.05
R1173:Vdr	UTSW	15	97869333	missense	probably benign	0.05
R1268:Vdr	UTSW	15	97857475	missense	probably benign	0.39
R1705:Vdr	UTSW	15	97867171	missense	probably damaging	1.00
R2879:Vdr	UTSW	15	97859127	missense	probably benign	0.01
R3030:Vdr	UTSW	15	97857563	missense	probably benign	0.00
R4695:Vdr	UTSW	15	97858920	splice site	probably null
R5074:Vdr	UTSW	15	97857578	missense	probably benign	0.35
R5710:Vdr	UTSW	15	97859127	missense	probably damaging	1.00
R5710:Vdr	UTSW	15	97867208	missense	probably benign	0.02
R5845:Vdr	UTSW	15	97869766	missense	possibly damaging	0.46
R6776:Vdr	UTSW	15	97869828	missense	probably damaging	1.00
R6865:Vdr	UTSW	15	97857505	missense	probably damaging	1.00
X0023:Vdr	UTSW	15	97869818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTCAGGAGATCTCATTGC -3'
(R):5'- TGAGCCCAGGAAAGGACTTG -3'

Sequencing Primer
(F):5'- GTCAGGAGATCTCATTGCCGAAC -3'
(R):5'- ACTTGGTCCTAAATGCAGGG -3'

Posted On

2017-06-26