Incidental Mutation 'R5982:Nrros'
ID481499
Institutional Source Beutler Lab
Gene Symbol Nrros
Ensembl Gene ENSMUSG00000052384
Gene Namenegative regulator of reactive oxygen species
SynonymsLrrc33, E430025L02Rik
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5982 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32142785-32165594 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32144593 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 202 (D202G)
Ref Sequence ENSEMBL: ENSMUSP00000110817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099991] [ENSMUST00000115163] [ENSMUST00000115165] [ENSMUST00000126869] [ENSMUST00000130410] [ENSMUST00000143682] [ENSMUST00000144345] [ENSMUST00000231836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099991
AA Change: D174G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097571
Gene: ENSMUSG00000052384
AA Change: D174G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115163
AA Change: D202G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110817
Gene: ENSMUSG00000052384
AA Change: D202G

DomainStartEndE-ValueType
LRRNT 59 89 1.05e1 SMART
LRR 108 131 1.01e2 SMART
LRR 159 183 5.27e1 SMART
LRR 184 207 4.05e-1 SMART
LRR_TYP 208 231 7.67e-2 SMART
LRR 232 255 1.49e1 SMART
LRR_TYP 355 378 1.67e-2 SMART
LRR 404 428 3.27e1 SMART
LRR_TYP 429 452 1.79e-2 SMART
LRR 489 512 1.45e1 SMART
LRR 563 584 1.76e1 SMART
LRR 587 608 3.36e1 SMART
transmembrane domain 681 703 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115165
AA Change: D150G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110819
Gene: ENSMUSG00000052384
AA Change: D150G

DomainStartEndE-ValueType
Blast:LRRNT 8 37 5e-8 BLAST
LRR 56 79 1.01e2 SMART
LRR 107 131 5.27e1 SMART
LRR 132 155 4.05e-1 SMART
LRR_TYP 156 179 7.67e-2 SMART
LRR 180 203 1.49e1 SMART
LRR_TYP 303 326 1.67e-2 SMART
LRR 352 376 3.27e1 SMART
LRR_TYP 377 400 1.79e-2 SMART
LRR 437 460 1.45e1 SMART
LRR 511 532 1.76e1 SMART
LRR 535 556 3.36e1 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126869
AA Change: D174G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116388
Gene: ENSMUSG00000052384
AA Change: D174G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127287
Predicted Effect probably benign
Transcript: ENSMUST00000130410
SMART Domains Protein: ENSMUSP00000122290
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Pfam:LRR_7 81 97 1.9e-2 PFAM
Pfam:LRR_7 105 121 6.8e-2 PFAM
Pfam:LRR_7 133 144 2e-1 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136809
Predicted Effect possibly damaging
Transcript: ENSMUST00000143682
AA Change: D174G

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119349
Gene: ENSMUSG00000052384
AA Change: D174G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144345
SMART Domains Protein: ENSMUSP00000121492
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150250
Predicted Effect possibly damaging
Transcript: ENSMUST00000231836
AA Change: D166G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased oxidative stress and susceptibility to experimental autoimmune encephalomyelitis, but to reduced susceptibility to bacterial infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Nrros
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Nrros APN 16 32147620 missense probably benign 0.06
IGL01097:Nrros APN 16 32144185 missense possibly damaging 0.71
IGL02065:Nrros APN 16 32144674 missense possibly damaging 0.84
IGL03372:Nrros APN 16 32144770 missense probably damaging 1.00
R0615:Nrros UTSW 16 32144085 missense probably damaging 1.00
R0669:Nrros UTSW 16 32143423 missense probably damaging 1.00
R0840:Nrros UTSW 16 32143423 missense probably damaging 1.00
R1398:Nrros UTSW 16 32143144 missense probably damaging 0.98
R1796:Nrros UTSW 16 32143511 missense probably damaging 1.00
R2031:Nrros UTSW 16 32144157 nonsense probably null
R2033:Nrros UTSW 16 32144157 nonsense probably null
R2034:Nrros UTSW 16 32144157 nonsense probably null
R2087:Nrros UTSW 16 32144157 nonsense probably null
R2089:Nrros UTSW 16 32144157 nonsense probably null
R2090:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2151:Nrros UTSW 16 32143258 missense probably benign 0.11
R2438:Nrros UTSW 16 32144111 unclassified probably null
R2438:Nrros UTSW 16 32144299 missense probably benign 0.25
R5474:Nrros UTSW 16 32144352 missense probably benign 0.00
R5527:Nrros UTSW 16 32144470 missense probably damaging 1.00
R5629:Nrros UTSW 16 32144405 missense probably damaging 1.00
R5888:Nrros UTSW 16 32143087 missense probably benign 0.15
R5939:Nrros UTSW 16 32143454 missense probably benign 0.01
R6869:Nrros UTSW 16 32144431 missense probably damaging 1.00
R6912:Nrros UTSW 16 32162239 missense probably null 0.01
R7010:Nrros UTSW 16 32143580 missense probably damaging 0.96
R7469:Nrros UTSW 16 32144212 missense probably benign 0.14
R7673:Nrros UTSW 16 32162281 missense unknown
X0022:Nrros UTSW 16 32143040 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCCAATTCGAAGGCCACCTC -3'
(R):5'- TCTCGGAGAACTACAAGGAGTC -3'

Sequencing Primer
(F):5'- TGCCAGGAACCACTCTAGGATG -3'
(R):5'- CTACAAGGAGTCAGCCGCAG -3'
Posted On2017-06-26