Mutagenetix > Incidental Mutation

Incidental Mutation 'R5982:Dsg4'

481504

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

044163-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.633) question?

Stock #

R5982 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20465169 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 715 (S715T)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019426
AA Change: S715T

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: S715T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Meta Mutation Damage Score

0.0649

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,953,597	E931D	possibly damaging	Het
Aebp1	C	T	11: 5,867,911	T62I	possibly damaging	Het
Babam2	A	T	5: 31,820,620	E139V	possibly damaging	Het
Bclaf1	C	T	10: 20,323,063	R67*	probably null	Het
Bcr	C	A	10: 75,176,416	T51K	probably benign	Het
Best3	T	A	10: 117,004,417	C251S	probably damaging	Het
Birc6	A	G	17: 74,648,158	M3457V	probably benign	Het
C87436	C	A	6: 86,445,975	T177K	possibly damaging	Het
Cabin1	T	A	10: 75,725,560	T1036S	probably benign	Het
Catsperg2	C	A	7: 29,713,017	V383L	possibly damaging	Het
Ccdc182	C	T	11: 88,294,339	Q82*	probably null	Het
Ccl9	T	C	11: 83,575,874	T76A	probably damaging	Het
Cdc16	G	T	8: 13,781,399	C544F	possibly damaging	Het
Cdh18	A	C	15: 23,474,216	D724A	possibly damaging	Het
Cdip1	G	A	16: 4,770,082	P6S	probably damaging	Het
Col12a1	A	G	9: 79,630,560	V2542A	probably damaging	Het
Dnajc13	G	T	9: 104,184,615	T1380K	possibly damaging	Het
Dync2h1	G	T	9: 6,955,986	T4132K	probably benign	Het
Egfem1	A	T	3: 29,657,270		probably null	Het
Etl4	G	T	2: 20,781,015	V716L	probably damaging	Het
Exoc3l2	A	G	7: 19,480,032	E461G	unknown	Het
Fam135b	A	G	15: 71,448,669		probably null	Het
Flrt3	G	T	2: 140,660,916	P264Q	possibly damaging	Het
Fmn2	G	C	1: 174,502,453	E136D	unknown	Het
Fosl2	A	G	5: 32,146,873	I51V	probably benign	Het
Foxm1	A	G	6: 128,371,035	T307A	probably damaging	Het
Garem1	T	C	18: 21,148,351	D316G	possibly damaging	Het
Gm13088	C	A	4: 143,654,464	V330F	probably damaging	Het
Gm14403	A	T	2: 177,508,552	H97L	probably damaging	Het
Gm5616	A	G	9: 48,450,590		noncoding transcript	Het
Hkdc1	T	C	10: 62,393,810	D696G	probably benign	Het
Igkv1-88	C	A	6: 68,862,448	W60L	probably damaging	Het
Iqgap3	G	A	3: 88,091,592	W333*	probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kcnk3	G	T	5: 30,622,670	V355L	probably benign	Het
Kmt5c	A	C	7: 4,746,791	K436T	probably damaging	Het
Lynx1	T	C	15: 74,751,415	Y56C	possibly damaging	Het
Lypd5	T	C	7: 24,353,037	S149P	probably damaging	Het
Map3k21	A	T	8: 125,911,430	N252Y	probably damaging	Het
Mgat2	T	C	12: 69,185,680	W343R	probably damaging	Het
Misp	T	G	10: 79,827,894	Y567*	probably null	Het
Mrgprb1	A	T	7: 48,447,820	S115T	probably benign	Het
Muc16	A	C	9: 18,647,146	I2617R	unknown	Het
Myo19	T	A	11: 84,899,400	V394E	probably damaging	Het
Myo9b	T	A	8: 71,348,396	L1065Q	probably benign	Het
Nap1l1	A	G	10: 111,495,368	D405G	possibly damaging	Het
Napb	A	T	2: 148,700,491		probably null	Het
Nbas	A	G	12: 13,393,430	Y1162C	probably benign	Het
Nfam1	A	T	15: 83,033,124	L36Q	probably damaging	Het
Nrros	T	C	16: 32,144,593	D202G	probably damaging	Het
Olfr1355	T	G	10: 78,879,953	Y260*	probably null	Het
Olfr639	T	G	7: 104,011,910	H264P	probably damaging	Het
Osgin2	T	C	4: 15,998,908	E238G	probably benign	Het
Papss2	A	G	19: 32,639,236	T221A	probably benign	Het
Pcdhga12	A	C	18: 37,768,031	K639Q	probably damaging	Het
Pkhd1l1	T	A	15: 44,489,504		probably null	Het
Pmepa1	A	G	2: 173,234,312	S83P	possibly damaging	Het
Pnp	G	A	14: 50,950,543	V118M	probably damaging	Het
Ppat	T	C	5: 76,915,265	T500A	probably benign	Het
Rab11fip4	A	G	11: 79,690,775	N532S	probably benign	Het
Rbm25	A	G	12: 83,671,951	D499G	probably damaging	Het
Rnf139	A	G	15: 58,898,838	I237M	possibly damaging	Het
Rrp15	C	T	1: 186,739,755	S85N	possibly damaging	Het
Sidt1	T	C	16: 44,261,708	Y568C	probably damaging	Het
Slirp	A	G	12: 87,444,014	T29A	probably damaging	Het
Sltm	G	C	9: 70,586,804	E828Q	probably damaging	Het
Spindoc	A	G	19: 7,374,595	I129T	probably damaging	Het
Spire1	T	A	18: 67,497,316		probably null	Het
Styx	A	G	14: 45,368,452	T138A	probably benign	Het
Sv2c	A	T	13: 95,976,063	L642*	probably null	Het
Taf7	T	C	18: 37,643,445	E23G	probably damaging	Het
Tcp10a	A	T	17: 7,345,026	T406S	possibly damaging	Het
Tnrc6b	T	A	15: 80,880,816	S840T	probably benign	Het
Tns3	A	G	11: 8,492,245	I706T	probably damaging	Het
Tpsab1	A	G	17: 25,345,372	V36A	probably benign	Het
Trafd1	T	A	5: 121,373,279	D492V	probably damaging	Het
Trp53	A	G	11: 69,587,418	E51G	probably benign	Het
Vdr	C	T	15: 97,857,596	A349T	probably benign	Het
Vmn2r59	T	C	7: 42,046,067	D307G	probably benign	Het
Zfp365	C	A	10: 67,897,607	V252F	probably damaging	Het
Zfp830	T	A	11: 82,764,977	N202K	probably benign	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
woodshed	UTSW	18	20451872	nonsense	probably null
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62
R9508:Dsg4	UTSW	18	20471013	missense	probably damaging	1.00
R9607:Dsg4	UTSW	18	20452990	missense	probably benign	0.00
R9765:Dsg4	UTSW	18	20471277	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTTCTATGGGAGCTCAGCCG -3'
(R):5'- CCCAGTTATGGTTTCAGAATGTGC -3'

Sequencing Primer
(F):5'- GGCCTTGACAATTCCATGCAG -3'
(R):5'- GGTTTCAGAATGTGCCTGTTAAATC -3'

Posted On

2017-06-26