Incidental Mutation 'R5983:Nvl'
ID 481511
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 044164-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R5983 (G1)
Quality Score 109.008
Status Validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 180964471 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 102 (D102E)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: D102E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: D102E

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193758
Meta Mutation Damage Score 0.1580 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,807,942 (GRCm39) M861K probably benign Het
Abhd18 T A 3: 40,864,979 (GRCm39) F73L probably damaging Het
Abraxas1 A G 5: 100,955,777 (GRCm39) V237A probably benign Het
Adam26b T C 8: 43,974,378 (GRCm39) Y208C probably damaging Het
Aire A G 10: 77,878,903 (GRCm39) L48P probably damaging Het
Bach2 A T 4: 32,563,324 (GRCm39) E597V probably damaging Het
Ccdc170 A T 10: 4,470,851 (GRCm39) R232* probably null Het
Cfap100 A C 6: 90,396,373 (GRCm39) probably benign Het
Dppa2 G A 16: 48,136,204 (GRCm39) M185I probably benign Het
Ecsit C T 9: 21,989,443 (GRCm39) probably null Het
Fbxw26 A G 9: 109,547,033 (GRCm39) I464T possibly damaging Het
Grm8 T C 6: 27,760,220 (GRCm39) K370R probably benign Het
Ide C T 19: 37,249,549 (GRCm39) probably null Het
Katnip T A 7: 125,449,545 (GRCm39) W870R probably damaging Het
Morn3 T C 5: 123,175,851 (GRCm39) D179G possibly damaging Het
Nkapd1 A G 9: 50,519,142 (GRCm39) S157P probably damaging Het
Or5an10 T A 19: 12,276,467 (GRCm39) I10F probably benign Het
Rbm5 G A 9: 107,622,141 (GRCm39) P611L probably damaging Het
Rsph9 A G 17: 46,440,406 (GRCm39) M230T probably benign Het
Sacs G A 14: 61,442,648 (GRCm39) V1565M probably damaging Het
Serpina3n T C 12: 104,375,288 (GRCm39) L120P probably damaging Het
Spsb2 A C 6: 124,786,711 (GRCm39) E148A probably benign Het
Tmc2 T A 2: 130,089,896 (GRCm39) M627K probably damaging Het
Tmem147 T C 7: 30,427,484 (GRCm39) D111G probably damaging Het
Ttn A G 2: 76,572,725 (GRCm39) V17729A possibly damaging Het
Vmn2r104 G A 17: 20,261,970 (GRCm39) P387S probably damaging Het
Zfp940 C T 7: 29,544,477 (GRCm39) V477M possibly damaging Het
Zw10 A G 9: 48,988,745 (GRCm39) probably null Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AATTCCCAACAATCACATGGTGA -3'
(R):5'- AGAGGTCATTGTGATAGGAACCA -3'

Sequencing Primer
(F):5'- GTCTGAAGACAGCTACAGTGTTC -3'
(R):5'- CAGTGTAAGGCATCTCTAGCTCTCAG -3'
Posted On 2017-06-26