Incidental Mutation 'R5983:Grm8'
ID 481518
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Name glutamate receptor, metabotropic 8
Synonyms mGluR8, Gprc1h
MMRRC Submission 044164-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5983 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 27275120-28135094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27760220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 370 (K370R)
Ref Sequence ENSEMBL: ENSMUSP00000110979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897]
AlphaFold P47743
Predicted Effect probably benign
Transcript: ENSMUST00000090512
AA Change: K370R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: K370R

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115323
AA Change: K370R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: K370R

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115324
AA Change: K370R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: K370R

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131897
SMART Domains Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 294 5.8e-66 PFAM
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,807,942 (GRCm39) M861K probably benign Het
Abhd18 T A 3: 40,864,979 (GRCm39) F73L probably damaging Het
Abraxas1 A G 5: 100,955,777 (GRCm39) V237A probably benign Het
Adam26b T C 8: 43,974,378 (GRCm39) Y208C probably damaging Het
Aire A G 10: 77,878,903 (GRCm39) L48P probably damaging Het
Bach2 A T 4: 32,563,324 (GRCm39) E597V probably damaging Het
Ccdc170 A T 10: 4,470,851 (GRCm39) R232* probably null Het
Cfap100 A C 6: 90,396,373 (GRCm39) probably benign Het
Dppa2 G A 16: 48,136,204 (GRCm39) M185I probably benign Het
Ecsit C T 9: 21,989,443 (GRCm39) probably null Het
Fbxw26 A G 9: 109,547,033 (GRCm39) I464T possibly damaging Het
Ide C T 19: 37,249,549 (GRCm39) probably null Het
Katnip T A 7: 125,449,545 (GRCm39) W870R probably damaging Het
Morn3 T C 5: 123,175,851 (GRCm39) D179G possibly damaging Het
Nkapd1 A G 9: 50,519,142 (GRCm39) S157P probably damaging Het
Nvl A T 1: 180,964,471 (GRCm39) D102E probably benign Het
Or5an10 T A 19: 12,276,467 (GRCm39) I10F probably benign Het
Rbm5 G A 9: 107,622,141 (GRCm39) P611L probably damaging Het
Rsph9 A G 17: 46,440,406 (GRCm39) M230T probably benign Het
Sacs G A 14: 61,442,648 (GRCm39) V1565M probably damaging Het
Serpina3n T C 12: 104,375,288 (GRCm39) L120P probably damaging Het
Spsb2 A C 6: 124,786,711 (GRCm39) E148A probably benign Het
Tmc2 T A 2: 130,089,896 (GRCm39) M627K probably damaging Het
Tmem147 T C 7: 30,427,484 (GRCm39) D111G probably damaging Het
Ttn A G 2: 76,572,725 (GRCm39) V17729A possibly damaging Het
Vmn2r104 G A 17: 20,261,970 (GRCm39) P387S probably damaging Het
Zfp940 C T 7: 29,544,477 (GRCm39) V477M possibly damaging Het
Zw10 A G 9: 48,988,745 (GRCm39) probably null Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27,363,800 (GRCm39) missense probably damaging 1.00
IGL01412:Grm8 APN 6 27,762,460 (GRCm39) missense probably damaging 1.00
IGL02329:Grm8 APN 6 27,363,115 (GRCm39) missense probably damaging 1.00
IGL02342:Grm8 APN 6 27,363,803 (GRCm39) missense probably benign 0.00
IGL02584:Grm8 APN 6 27,762,438 (GRCm39) missense probably benign 0.35
IGL03040:Grm8 APN 6 28,126,122 (GRCm39) start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27,363,262 (GRCm39) missense probably damaging 1.00
IGL03139:Grm8 APN 6 27,618,649 (GRCm39) missense probably damaging 1.00
IGL03287:Grm8 APN 6 27,760,254 (GRCm39) missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27,762,389 (GRCm39) missense probably damaging 0.99
R0266:Grm8 UTSW 6 27,285,895 (GRCm39) missense probably damaging 1.00
R0347:Grm8 UTSW 6 27,981,221 (GRCm39) missense probably benign 0.37
R0580:Grm8 UTSW 6 27,761,370 (GRCm39) splice site probably benign
R0698:Grm8 UTSW 6 27,363,913 (GRCm39) missense probably damaging 1.00
R0833:Grm8 UTSW 6 27,363,178 (GRCm39) missense probably damaging 1.00
R1301:Grm8 UTSW 6 27,981,200 (GRCm39) missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1323:Grm8 UTSW 6 28,125,973 (GRCm39) missense probably damaging 1.00
R1471:Grm8 UTSW 6 27,363,308 (GRCm39) missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28,125,852 (GRCm39) missense probably benign 0.01
R1638:Grm8 UTSW 6 28,125,882 (GRCm39) nonsense probably null
R1763:Grm8 UTSW 6 27,285,866 (GRCm39) missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28,125,894 (GRCm39) missense probably damaging 1.00
R1902:Grm8 UTSW 6 27,429,481 (GRCm39) missense probably damaging 1.00
R1916:Grm8 UTSW 6 27,363,583 (GRCm39) missense probably benign 0.01
R2257:Grm8 UTSW 6 27,760,224 (GRCm39) missense probably damaging 0.98
R2351:Grm8 UTSW 6 28,126,118 (GRCm39) missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27,761,241 (GRCm39) missense probably damaging 0.98
R3801:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28,125,635 (GRCm39) missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27,761,228 (GRCm39) nonsense probably null
R3844:Grm8 UTSW 6 27,429,507 (GRCm39) missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27,981,229 (GRCm39) missense probably damaging 1.00
R4077:Grm8 UTSW 6 27,760,208 (GRCm39) missense probably benign 0.01
R4395:Grm8 UTSW 6 27,429,431 (GRCm39) missense probably damaging 0.98
R4436:Grm8 UTSW 6 27,761,237 (GRCm39) missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27,761,295 (GRCm39) missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27,762,418 (GRCm39) missense probably damaging 1.00
R5677:Grm8 UTSW 6 27,761,203 (GRCm39) critical splice donor site probably null
R5990:Grm8 UTSW 6 27,363,623 (GRCm39) missense probably damaging 1.00
R6365:Grm8 UTSW 6 27,363,226 (GRCm39) missense probably damaging 1.00
R6454:Grm8 UTSW 6 27,363,775 (GRCm39) missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27,363,190 (GRCm39) missense probably damaging 1.00
R6960:Grm8 UTSW 6 27,981,281 (GRCm39) missense probably damaging 0.98
R7194:Grm8 UTSW 6 27,618,486 (GRCm39) missense probably benign 0.01
R7259:Grm8 UTSW 6 27,760,175 (GRCm39) missense probably null 0.99
R7305:Grm8 UTSW 6 27,761,354 (GRCm39) missense possibly damaging 0.51
R7421:Grm8 UTSW 6 27,762,476 (GRCm39) missense possibly damaging 0.66
R7561:Grm8 UTSW 6 27,429,524 (GRCm39) missense probably benign 0.44
R7605:Grm8 UTSW 6 27,618,678 (GRCm39) missense probably damaging 1.00
R7651:Grm8 UTSW 6 27,760,257 (GRCm39) missense possibly damaging 0.46
R7775:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7778:Grm8 UTSW 6 27,363,671 (GRCm39) missense possibly damaging 0.89
R7781:Grm8 UTSW 6 27,285,786 (GRCm39) missense probably benign
R7785:Grm8 UTSW 6 27,618,636 (GRCm39) missense probably damaging 0.99
R7898:Grm8 UTSW 6 27,762,422 (GRCm39) missense probably damaging 1.00
R8272:Grm8 UTSW 6 27,363,281 (GRCm39) missense probably damaging 1.00
R8274:Grm8 UTSW 6 27,761,335 (GRCm39) missense probably benign 0.31
R8501:Grm8 UTSW 6 27,618,540 (GRCm39) missense probably damaging 0.98
R8695:Grm8 UTSW 6 28,126,030 (GRCm39) missense probably benign 0.01
R8824:Grm8 UTSW 6 27,761,351 (GRCm39) missense probably damaging 1.00
R8869:Grm8 UTSW 6 27,363,752 (GRCm39) missense probably benign 0.26
R9322:Grm8 UTSW 6 27,363,728 (GRCm39) missense possibly damaging 0.88
R9337:Grm8 UTSW 6 27,761,214 (GRCm39) missense probably benign 0.01
R9518:Grm8 UTSW 6 27,429,469 (GRCm39) missense probably benign 0.01
RF013:Grm8 UTSW 6 27,363,779 (GRCm39) missense probably damaging 1.00
Z1176:Grm8 UTSW 6 28,126,026 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGTTTACTGAGTGCTGAGCTCG -3'
(R):5'- AAACACTTCTTCAAAGTTCTGGTGG -3'

Sequencing Primer
(F):5'- TAAGTTTGCAAGACCTAGGGGCC -3'
(R):5'- TCTTCAAAGTTCTGGTGGTATTTTG -3'
Posted On 2017-06-26