Incidental Mutation 'R5983:Zfp940'
ID481521
Institutional Source Beutler Lab
Gene Symbol Zfp940
Ensembl Gene ENSMUSG00000050855
Gene Namezinc finger protein 940
SynonymsBC027344
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5983 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29833620-29853669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29845052 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 477 (V477M)
Ref Sequence ENSEMBL: ENSMUSP00000082947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085792] [ENSMUST00000108223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085792
AA Change: V477M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082947
Gene: ENSMUSG00000050855
AA Change: V477M

DomainStartEndE-ValueType
KRAB 6 66 1.05e-31 SMART
ZnF_C2H2 251 273 3.69e-4 SMART
ZnF_C2H2 279 301 5.5e-3 SMART
ZnF_C2H2 307 329 7.67e-2 SMART
ZnF_C2H2 340 362 2.71e-2 SMART
ZnF_C2H2 368 390 5.34e-1 SMART
ZnF_C2H2 396 418 1.38e-3 SMART
ZnF_C2H2 424 446 3.39e-3 SMART
ZnF_C2H2 452 474 6.78e-3 SMART
ZnF_C2H2 485 507 4.79e-3 SMART
ZnF_C2H2 513 535 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108223
SMART Domains Protein: ENSMUSP00000103858
Gene: ENSMUSG00000050855

DomainStartEndE-ValueType
KRAB 6 67 2.42e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145098
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Zfp940
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Zfp940 APN 7 29846870 missense probably damaging 1.00
IGL02092:Zfp940 APN 7 29846201 missense probably benign
IGL02498:Zfp940 APN 7 29846951 missense probably damaging 0.97
R0503:Zfp940 UTSW 7 29846020 intron probably benign
R0614:Zfp940 UTSW 7 29846246 missense probably benign 0.03
R1604:Zfp940 UTSW 7 29846075 missense probably benign
R1619:Zfp940 UTSW 7 29845537 missense possibly damaging 0.85
R1715:Zfp940 UTSW 7 29844938 missense probably damaging 0.96
R1749:Zfp940 UTSW 7 29845527 nonsense probably null
R1862:Zfp940 UTSW 7 29845010 missense probably damaging 1.00
R4017:Zfp940 UTSW 7 29845934 missense probably benign
R4673:Zfp940 UTSW 7 29845438 missense probably benign 0.00
R4761:Zfp940 UTSW 7 29846153 missense probably benign 0.12
R4890:Zfp940 UTSW 7 29845399 missense probably benign 0.01
R5027:Zfp940 UTSW 7 29850956 utr 5 prime probably benign
R5285:Zfp940 UTSW 7 29845600 missense probably damaging 0.99
R5340:Zfp940 UTSW 7 29844841 missense probably benign 0.33
R5439:Zfp940 UTSW 7 29845433 missense probably benign 0.02
R7873:Zfp940 UTSW 7 29835617 missense unknown
R7956:Zfp940 UTSW 7 29835617 missense unknown
R8035:Zfp940 UTSW 7 29845523 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CGACATAGTTGTGGTCTTCAAGG -3'
(R):5'- CATCACAGAGTTCACACAGGTG -3'

Sequencing Primer
(F):5'- CACCAGTGTGAATTCTCTGATG -3'
(R):5'- TGAGAGGCCGTACACGTGTC -3'
Posted On2017-06-26