Incidental Mutation 'R5983:Tmem147'
ID481522
Institutional Source Beutler Lab
Gene Symbol Tmem147
Ensembl Gene ENSMUSG00000006315
Gene Nametransmembrane protein 147
Synonyms5033425B17Rik, 2010004E11Rik
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R5983 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30727701-30729540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30728059 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 111 (D111G)
Ref Sequence ENSEMBL: ENSMUSP00000146918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000006478] [ENSMUST00000074758] [ENSMUST00000170371] [ENSMUST00000182067] [ENSMUST00000182634] [ENSMUST00000207263] [ENSMUST00000207296] [ENSMUST00000207779] [ENSMUST00000208169] [ENSMUST00000209065]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000006478
AA Change: D160G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006478
Gene: ENSMUSG00000006315
AA Change: D160G

DomainStartEndE-ValueType
Pfam:DUF2053 2 158 3.1e-69 PFAM
transmembrane domain 168 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074758
SMART Domains Protein: ENSMUSP00000074317
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Gp_dh_N 106 254 6.13e-79 SMART
Pfam:Gp_dh_C 259 416 2.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect probably benign
Transcript: ENSMUST00000170371
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180820
SMART Domains Protein: ENSMUSP00000137757
Gene: ENSMUSG00000097320

DomainStartEndE-ValueType
SCOP:d1i7oa2 53 93 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182067
SMART Domains Protein: ENSMUSP00000138697
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
PDB:2VYV|D 1 44 3e-15 PDB
Blast:Gp_dh_N 4 33 9e-7 BLAST
SCOP:d1cf2o2 9 45 3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182634
SMART Domains Protein: ENSMUSP00000138634
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
Gp_dh_N 108 256 6.13e-79 SMART
Pfam:Gp_dh_C 261 418 4.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183194
Predicted Effect probably benign
Transcript: ENSMUST00000207263
Predicted Effect probably damaging
Transcript: ENSMUST00000207296
AA Change: D167G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207955
Predicted Effect probably damaging
Transcript: ENSMUST00000208169
AA Change: D86G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209065
AA Change: D111G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6208 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Tmem147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tmem147 APN 7 30728433 nonsense probably null
IGL02491:Tmem147 APN 7 30728201 splice site probably benign
IGL02971:Tmem147 APN 7 30729422 unclassified probably benign
R0070:Tmem147 UTSW 7 30728101 missense probably damaging 1.00
R0609:Tmem147 UTSW 7 30728102 missense probably benign 0.03
R1167:Tmem147 UTSW 7 30727796 missense probably benign 0.33
R1254:Tmem147 UTSW 7 30729370 nonsense probably null
R6072:Tmem147 UTSW 7 30728020 missense possibly damaging 0.56
R7636:Tmem147 UTSW 7 30728301 splice site probably null
R7705:Tmem147 UTSW 7 30728291 critical splice acceptor site probably null
R8042:Tmem147 UTSW 7 30728553 missense probably damaging 0.97
R8132:Tmem147 UTSW 7 30728447 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCCTGTTACTACTGCCCG -3'
(R):5'- CAGATGAGCATTGACTCCAACATC -3'

Sequencing Primer
(F):5'- GAGCAGTGCTGTCCAACTAC -3'
(R):5'- ACATCAGTCTGGTATGCAGTCTAGC -3'
Posted On2017-06-26