Mutagenetix > Incidental Mutations

Incidental Mutation 'R5983:D430042O09Rik'

481523

Institutional Source

Beutler Lab

Gene Symbol

D430042O09Rik

Ensembl Gene

ENSMUSG00000032743

Gene Name

RIKEN cDNA D430042O09 gene

Synonyms

MMRRC Submission

044164-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5983 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125707888-125874793 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 125850373 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 870 (W870R)

Ref Sequence

ENSEMBL: ENSMUSP00000118668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069660
AA Change: W896R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743
AA Change: W896R

Domain	Start	End	E-Value	Type
internal_repeat_3	442	586	9.64e-5	PROSPERO
internal_repeat_2	454	607	1.91e-6	PROSPERO
low complexity region	704	718	N/A	INTRINSIC
Pfam:DUF4457	909	1099	5.1e-43	PFAM
Pfam:DUF4457	1205	1524	8.4e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122337

SMART Domains

Protein: ENSMUSP00000113734
Gene: ENSMUSG00000032743

Domain	Start	End	E-Value	Type
Pfam:DUF4457	173	344	2.7e-9	PFAM
Pfam:DUF4457	218	394	3.2e-10	PFAM
low complexity region	444	458	N/A	INTRINSIC
Pfam:DUF4457	660	742	1.1e-14	PFAM
Pfam:DUF4457	733	863	2.6e-31	PFAM
Pfam:DUF4457	944	1008	5.9e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000124223
AA Change: W870R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743
AA Change: W870R

Domain	Start	End	E-Value	Type
internal_repeat_3	416	560	8.9e-5	PROSPERO
internal_repeat_2	428	581	1.74e-6	PROSPERO
low complexity region	678	692	N/A	INTRINSIC
Pfam:DUF4457	882	1073	1.4e-39	PFAM
Pfam:DUF4457	1179	1498	2.2e-145	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205462

Meta Mutation Damage Score

0.6436

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.6%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	A	19: 43,819,503	M861K	probably benign	Het
Abhd18	T	A	3: 40,910,544	F73L	probably damaging	Het
Abraxas1	A	G	5: 100,807,911	V237A	probably benign	Het
Adam26b	T	C	8: 43,521,341	Y208C	probably damaging	Het
Aire	A	G	10: 78,043,069	L48P	probably damaging	Het
AU019823	A	G	9: 50,607,842	S157P	probably damaging	Het
Bach2	A	T	4: 32,563,324	E597V	probably damaging	Het
Ccdc170	A	T	10: 4,520,851	R232*	probably null	Het
Cfap100	A	C	6: 90,419,391		probably benign	Het
Dppa2	G	A	16: 48,315,841	M185I	probably benign	Het
Ecsit	C	T	9: 22,078,147		probably null	Het
Fbxw26	A	G	9: 109,717,965	I464T	possibly damaging	Het
Grm8	T	C	6: 27,760,221	K370R	probably benign	Het
Ide	C	T	19: 37,272,150		probably null	Het
Morn3	T	C	5: 123,037,788	D179G	possibly damaging	Het
Nvl	A	T	1: 181,136,906	D102E	probably benign	Het
Olfr1436	T	A	19: 12,299,103	I10F	probably benign	Het
Rbm5	G	A	9: 107,744,942	P611L	probably damaging	Het
Rsph9	A	G	17: 46,129,480	M230T	probably benign	Het
Sacs	G	A	14: 61,205,199	V1565M	probably damaging	Het
Serpina3n	T	C	12: 104,409,029	L120P	probably damaging	Het
Spsb2	A	C	6: 124,809,748	E148A	probably benign	Het
Tmc2	T	A	2: 130,247,976	M627K	probably damaging	Het
Tmem147	T	C	7: 30,728,059	D111G	probably damaging	Het
Ttn	A	G	2: 76,742,381	V17729A	possibly damaging	Het
Vmn2r104	G	A	17: 20,041,708	P387S	probably damaging	Het
Zfp940	C	T	7: 29,845,052	V477M	possibly damaging	Het
Zw10	A	G	9: 49,077,445		probably null	Het

Other mutations in D430042O09Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00697:D430042O09Rik	APN	7	125795450	missense	possibly damaging	0.75
IGL00950:D430042O09Rik	APN	7	125843221	missense	probably benign
IGL01089:D430042O09Rik	APN	7	125795313	missense	probably damaging	1.00
IGL01099:D430042O09Rik	APN	7	125865320	missense	probably damaging	1.00
IGL01449:D430042O09Rik	APN	7	125870685	missense	probably damaging	1.00
IGL01545:D430042O09Rik	APN	7	125752971	critical splice acceptor site	probably null
IGL01937:D430042O09Rik	APN	7	125854605	missense	probably benign	0.13
IGL01949:D430042O09Rik	APN	7	125761842	nonsense	probably null
IGL02096:D430042O09Rik	APN	7	125814821	missense	probably benign	0.09
IGL02148:D430042O09Rik	APN	7	125873476	splice site	probably null
IGL02274:D430042O09Rik	APN	7	125770570	critical splice acceptor site	probably null
IGL02323:D430042O09Rik	APN	7	125842829	missense	probably benign	0.04
IGL02574:D430042O09Rik	APN	7	125829753	missense	possibly damaging	0.48
IGL02639:D430042O09Rik	APN	7	125872792	missense	probably damaging	1.00
IGL02833:D430042O09Rik	APN	7	125850412	nonsense	probably null
IGL03003:D430042O09Rik	APN	7	125851960	missense	probably damaging	1.00
IGL03011:D430042O09Rik	APN	7	125852002	missense	probably benign	0.01
IGL03332:D430042O09Rik	APN	7	125820105	nonsense	probably null
IGL03368:D430042O09Rik	APN	7	125868858	intron	probably benign
E0370:D430042O09Rik	UTSW	7	125850302	missense	probably benign	0.06
PIT4498001:D430042O09Rik	UTSW	7	125813596	missense	probably benign
R0033:D430042O09Rik	UTSW	7	125761827	missense	possibly damaging	0.77
R0033:D430042O09Rik	UTSW	7	125761827	missense	possibly damaging	0.77
R0234:D430042O09Rik	UTSW	7	125795385	missense	probably benign	0.00
R0234:D430042O09Rik	UTSW	7	125795385	missense	probably benign	0.00
R0472:D430042O09Rik	UTSW	7	125872967	missense	probably damaging	0.98
R0479:D430042O09Rik	UTSW	7	125843346	missense	probably benign	0.20
R1195:D430042O09Rik	UTSW	7	125866482	missense	probably damaging	1.00
R1195:D430042O09Rik	UTSW	7	125866482	missense	probably damaging	1.00
R1195:D430042O09Rik	UTSW	7	125866482	missense	probably damaging	1.00
R1223:D430042O09Rik	UTSW	7	125760423	missense	possibly damaging	0.75
R1299:D430042O09Rik	UTSW	7	125852023	missense	probably benign
R1331:D430042O09Rik	UTSW	7	125866455	missense	probably benign	0.00
R1484:D430042O09Rik	UTSW	7	125816571	splice site	probably benign
R1507:D430042O09Rik	UTSW	7	125866352	missense	probably damaging	1.00
R1562:D430042O09Rik	UTSW	7	125842848	missense	probably damaging	1.00
R1992:D430042O09Rik	UTSW	7	125820089	missense	probably benign	0.00
R2008:D430042O09Rik	UTSW	7	125860566	missense	probably damaging	1.00
R2010:D430042O09Rik	UTSW	7	125872956	missense	possibly damaging	0.93
R2147:D430042O09Rik	UTSW	7	125865320	missense	probably damaging	1.00
R2508:D430042O09Rik	UTSW	7	125795343	missense	probably benign
R3015:D430042O09Rik	UTSW	7	125866340	missense	probably damaging	1.00
R3794:D430042O09Rik	UTSW	7	125820089	missense	probably benign	0.00
R3795:D430042O09Rik	UTSW	7	125820089	missense	probably benign	0.00
R4043:D430042O09Rik	UTSW	7	125868741	missense	probably benign	0.30
R4044:D430042O09Rik	UTSW	7	125868741	missense	probably benign	0.30
R4692:D430042O09Rik	UTSW	7	125867669	critical splice donor site	probably null
R4772:D430042O09Rik	UTSW	7	125865351	missense	probably damaging	0.96
R5155:D430042O09Rik	UTSW	7	125872184	missense	probably damaging	1.00
R5467:D430042O09Rik	UTSW	7	125843355	missense	possibly damaging	0.65
R5551:D430042O09Rik	UTSW	7	125820077	missense	probably damaging	1.00
R5560:D430042O09Rik	UTSW	7	125854561	missense	probably benign	0.00
R5662:D430042O09Rik	UTSW	7	125842703	missense	probably benign	0.00
R5667:D430042O09Rik	UTSW	7	125843455	critical splice donor site	probably null
R5838:D430042O09Rik	UTSW	7	125867655	missense	possibly damaging	0.88
R5958:D430042O09Rik	UTSW	7	125813635	missense	probably benign	0.01
R6084:D430042O09Rik	UTSW	7	125814865	missense	probably benign
R6241:D430042O09Rik	UTSW	7	125872834	missense	probably benign	0.00
R6298:D430042O09Rik	UTSW	7	125870697	missense	probably benign	0.11
R6345:D430042O09Rik	UTSW	7	125752987	missense	probably damaging	0.97
R6554:D430042O09Rik	UTSW	7	125850742	missense	probably damaging	1.00
R6715:D430042O09Rik	UTSW	7	125761829	nonsense	probably null
R6745:D430042O09Rik	UTSW	7	125770650	missense	probably benign	0.00
R7178:D430042O09Rik	UTSW	7	125866327	missense	probably benign	0.00
R7210:D430042O09Rik	UTSW	7	125872239	missense	probably damaging	1.00
R7404:D430042O09Rik	UTSW	7	125865262	missense	probably damaging	1.00
R7561:D430042O09Rik	UTSW	7	125842722	missense	probably benign
R7571:D430042O09Rik	UTSW	7	125708021	unclassified	probably benign
R7584:D430042O09Rik	UTSW	7	125870666	missense	probably damaging	0.99
R7629:D430042O09Rik	UTSW	7	125795250	missense	probably damaging	0.96
R7676:D430042O09Rik	UTSW	7	125850377	missense	probably benign	0.26
R7748:D430042O09Rik	UTSW	7	125829801	missense	probably benign	0.00
R7786:D430042O09Rik	UTSW	7	125865294	missense	probably benign	0.19
R8058:D430042O09Rik	UTSW	7	125843016	missense	probably benign	0.17
R8154:D430042O09Rik	UTSW	7	125813630	missense	probably damaging	0.98
R8204:D430042O09Rik	UTSW	7	125850742	missense	probably damaging	1.00
R8359:D430042O09Rik	UTSW	7	125868851	critical splice donor site	probably null
U24488:D430042O09Rik	UTSW	7	125770681	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GAATGAATCTGGCTTGGCGG -3'
(R):5'- TTAAAGTCGCTGTCACCACC -3'

Sequencing Primer
(F):5'- GACAGGATTGACACATCCTTCTTGG -3'
(R):5'- ACCCATCTCTGTGGAGGG -3'

Posted On

2017-06-26