Incidental Mutation 'R5983:Fbxw26'
ID481528
Institutional Source Beutler Lab
Gene Symbol Fbxw26
Ensembl Gene ENSMUSG00000059547
Gene NameF-box and WD-40 domain protein 26
SynonymsGm5163
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5983 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109717566-109746089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109717965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 464 (I464T)
Ref Sequence ENSEMBL: ENSMUSP00000071811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071917]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071917
AA Change: I464T

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071811
Gene: ENSMUSG00000059547
AA Change: I464T

DomainStartEndE-ValueType
FBOX 5 45 2.54e-6 SMART
SCOP:d1tbga_ 128 249 1e-5 SMART
Blast:WD40 137 176 4e-7 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Fbxw26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Fbxw26 APN 9 109717948 utr 3 prime probably benign
IGL01072:Fbxw26 APN 9 109723837 missense probably damaging 1.00
IGL01151:Fbxw26 APN 9 109721780 missense possibly damaging 0.50
IGL01394:Fbxw26 APN 9 109717989 missense probably benign 0.00
IGL01432:Fbxw26 APN 9 109717975 missense probably benign 0.32
IGL02559:Fbxw26 APN 9 109722164 missense probably benign 0.34
IGL02981:Fbxw26 APN 9 109744794 missense probably benign 0.09
IGL03370:Fbxw26 APN 9 109746019 missense probably damaging 1.00
R0023:Fbxw26 UTSW 9 109718011 missense probably benign 0.01
R0087:Fbxw26 UTSW 9 109724938 missense probably benign
R0369:Fbxw26 UTSW 9 109723712 critical splice donor site probably null
R0446:Fbxw26 UTSW 9 109743720 missense probably benign 0.03
R1844:Fbxw26 UTSW 9 109724878 missense probably benign 0.42
R1891:Fbxw26 UTSW 9 109722164 missense probably benign 0.34
R2042:Fbxw26 UTSW 9 109732704 missense probably damaging 1.00
R3615:Fbxw26 UTSW 9 109743760 nonsense probably null
R3616:Fbxw26 UTSW 9 109743760 nonsense probably null
R4659:Fbxw26 UTSW 9 109744871 missense probably damaging 0.97
R4785:Fbxw26 UTSW 9 109724800 missense possibly damaging 0.50
R4898:Fbxw26 UTSW 9 109717969 missense possibly damaging 0.95
R5791:Fbxw26 UTSW 9 109745153 missense probably damaging 1.00
R5818:Fbxw26 UTSW 9 109732566 missense probably benign
R5921:Fbxw26 UTSW 9 109746018 missense probably damaging 1.00
R6145:Fbxw26 UTSW 9 109732623 missense probably benign 0.09
R6209:Fbxw26 UTSW 9 109717965 missense possibly damaging 0.49
R6412:Fbxw26 UTSW 9 109732647 missense probably damaging 0.97
R6842:Fbxw26 UTSW 9 109724920 missense probably damaging 1.00
R7228:Fbxw26 UTSW 9 109724944 missense possibly damaging 0.93
R7451:Fbxw26 UTSW 9 109732623 missense probably benign 0.03
R7467:Fbxw26 UTSW 9 109732697 missense probably benign 0.00
X0020:Fbxw26 UTSW 9 109732632 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAAATGATTTGTACATCTAGCC -3'
(R):5'- TCAGATAGGTACACACAGGCAC -3'

Sequencing Primer
(F):5'- TAGATCAGGCTGGTCTCAGAACTC -3'
(R):5'- TATGAACTCGGCATCTCTGGAAG -3'
Posted On2017-06-26