Incidental Mutation 'R5983:Ccdc170'
ID481529
Institutional Source Beutler Lab
Gene Symbol Ccdc170
Ensembl Gene ENSMUSG00000019767
Gene Namecoiled-coil domain containing 170
SynonymsGm221, LOC237250
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5983 (G1)
Quality Score138.008
Status Validated
Chromosome10
Chromosomal Location4482502-4562231 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4520851 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 232 (R232*)
Ref Sequence ENSEMBL: ENSMUSP00000115997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019901] [ENSMUST00000138112]
Predicted Effect probably null
Transcript: ENSMUST00000019901
AA Change: R226*
SMART Domains Protein: ENSMUSP00000019901
Gene: ENSMUSG00000019767
AA Change: R226*

DomainStartEndE-ValueType
coiled coil region 40 160 N/A INTRINSIC
coiled coil region 264 302 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
coiled coil region 379 415 N/A INTRINSIC
coiled coil region 475 649 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138112
AA Change: R232*
SMART Domains Protein: ENSMUSP00000115997
Gene: ENSMUSG00000019767
AA Change: R232*

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
internal_repeat_1 80 93 6.25e-5 PROSPERO
internal_repeat_1 305 318 6.25e-5 PROSPERO
low complexity region 351 363 N/A INTRINSIC
coiled coil region 385 421 N/A INTRINSIC
coiled coil region 481 655 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene and its encoded protein is not known. Several genome-wide association studies have implicated the region around this gene to be involved in breast cancer and bone mineral density, but no link to this specific gene has been found. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Ccdc170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ccdc170 APN 10 4546836 missense probably damaging 1.00
IGL01018:Ccdc170 APN 10 4512788 missense probably benign
IGL01018:Ccdc170 APN 10 4514155 missense probably benign 0.00
IGL01018:Ccdc170 APN 10 4514114 missense probably benign
IGL01114:Ccdc170 APN 10 4558550 missense probably benign 0.01
IGL01377:Ccdc170 APN 10 4560966 missense probably damaging 1.00
IGL01726:Ccdc170 APN 10 4549713 missense probably benign 0.04
IGL02110:Ccdc170 APN 10 4541885 splice site probably null
FR4304:Ccdc170 UTSW 10 4561021 small insertion probably benign
FR4548:Ccdc170 UTSW 10 4561026 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4737:Ccdc170 UTSW 10 4561029 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561008 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561023 small insertion probably benign
FR4976:Ccdc170 UTSW 10 4561029 small insertion probably benign
R0137:Ccdc170 UTSW 10 4546950 splice site probably benign
R0280:Ccdc170 UTSW 10 4558663 missense possibly damaging 0.62
R0480:Ccdc170 UTSW 10 4518939 missense probably benign 0.00
R1786:Ccdc170 UTSW 10 4519043 missense probably benign 0.02
R2383:Ccdc170 UTSW 10 4534208 missense probably benign 0.00
R3031:Ccdc170 UTSW 10 4518931 missense probably damaging 0.99
R3797:Ccdc170 UTSW 10 4560920 missense possibly damaging 0.60
R4494:Ccdc170 UTSW 10 4514128 missense probably damaging 1.00
R4916:Ccdc170 UTSW 10 4518971 missense probably damaging 0.96
R5152:Ccdc170 UTSW 10 4561107 missense probably damaging 1.00
R5170:Ccdc170 UTSW 10 4514200 missense probably damaging 0.99
R5354:Ccdc170 UTSW 10 4534188 missense probably benign 0.16
R5911:Ccdc170 UTSW 10 4558551 nonsense probably null
R6374:Ccdc170 UTSW 10 4549746 nonsense probably null
R6645:Ccdc170 UTSW 10 4560974 missense possibly damaging 0.95
R6818:Ccdc170 UTSW 10 4541782 missense probably damaging 1.00
R6888:Ccdc170 UTSW 10 4546854 missense possibly damaging 0.91
R7032:Ccdc170 UTSW 10 4482597 missense unknown
R7206:Ccdc170 UTSW 10 4514120 missense possibly damaging 0.66
R7393:Ccdc170 UTSW 10 4514314 critical splice donor site probably null
R7438:Ccdc170 UTSW 10 4558512 nonsense probably null
R7471:Ccdc170 UTSW 10 4520803 missense probably benign 0.00
R7514:Ccdc170 UTSW 10 4546839 missense probably benign 0.37
R7818:Ccdc170 UTSW 10 4549603 missense probably benign 0.05
RF006:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF009:Ccdc170 UTSW 10 4561030 small insertion probably benign
RF011:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF017:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF023:Ccdc170 UTSW 10 4561018 small insertion probably benign
RF024:Ccdc170 UTSW 10 4561024 small insertion probably benign
RF025:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF027:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF029:Ccdc170 UTSW 10 4561026 small insertion probably benign
RF050:Ccdc170 UTSW 10 4561008 small insertion probably benign
RF064:Ccdc170 UTSW 10 4561025 small insertion probably benign
Z1177:Ccdc170 UTSW 10 4509884 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTGTAGACTGTGAGCTG -3'
(R):5'- CATGTCTTGCTTGGCTCATG -3'

Sequencing Primer
(F):5'- GTTTGGAGAAAACAGATGCGACC -3'
(R):5'- TCATGTCCCCCACACAGTG -3'
Posted On2017-06-26