Incidental Mutation 'R5983:Serpina3n'
ID481531
Institutional Source Beutler Lab
Gene Symbol Serpina3n
Ensembl Gene ENSMUSG00000021091
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3N
Synonymsantitrypsin, Spi2/eb.4, alpha-1 antiproteinase, Spi2.2, Spi2-2
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5983 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104406729-104414329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104409029 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 120 (L120P)
Ref Sequence ENSEMBL: ENSMUSP00000021506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021506]
Predicted Effect probably damaging
Transcript: ENSMUST00000021506
AA Change: L120P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021506
Gene: ENSMUSG00000021091
AA Change: L120P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 7.64e-194 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Serpina3n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Serpina3n APN 12 104412345 missense probably benign 0.39
IGL01930:Serpina3n APN 12 104408972 missense probably damaging 1.00
IGL01989:Serpina3n APN 12 104413491 missense probably benign
IGL02419:Serpina3n APN 12 104413518 missense possibly damaging 0.95
R0098:Serpina3n UTSW 12 104413518 missense probably damaging 1.00
R0098:Serpina3n UTSW 12 104413518 missense probably damaging 1.00
R0149:Serpina3n UTSW 12 104411376 missense probably benign 0.03
R1872:Serpina3n UTSW 12 104408944 missense probably benign 0.33
R1879:Serpina3n UTSW 12 104408954 missense probably benign 0.16
R2018:Serpina3n UTSW 12 104409214 missense probably damaging 0.97
R2315:Serpina3n UTSW 12 104412368 missense possibly damaging 0.77
R2968:Serpina3n UTSW 12 104409074 missense probably benign 0.12
R2969:Serpina3n UTSW 12 104409074 missense probably benign 0.12
R2970:Serpina3n UTSW 12 104409074 missense probably benign 0.12
R3409:Serpina3n UTSW 12 104411277 missense possibly damaging 0.93
R3410:Serpina3n UTSW 12 104411277 missense possibly damaging 0.93
R3411:Serpina3n UTSW 12 104411277 missense possibly damaging 0.93
R4030:Serpina3n UTSW 12 104411401 critical splice donor site probably null
R4388:Serpina3n UTSW 12 104411357 missense probably benign 0.11
R4659:Serpina3n UTSW 12 104413493 missense probably benign 0.03
R4728:Serpina3n UTSW 12 104409163 missense probably benign
R4783:Serpina3n UTSW 12 104409110 missense possibly damaging 0.84
R5001:Serpina3n UTSW 12 104408739 missense probably benign 0.00
R6767:Serpina3n UTSW 12 104409062 missense probably benign 0.01
R7001:Serpina3n UTSW 12 104408925 missense probably benign 0.00
R7468:Serpina3n UTSW 12 104411397 missense probably benign 0.16
X0027:Serpina3n UTSW 12 104411187 missense probably benign 0.00
X0067:Serpina3n UTSW 12 104411270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTCCATCAACACTGAC -3'
(R):5'- GGGTCTGTTTCCTCACATAGTC -3'

Sequencing Primer
(F):5'- CTACAAGGAGCTGGTTTTGAAGAATC -3'
(R):5'- TCCTCACATAGTCATTGATGAGC -3'
Posted On2017-06-26