Incidental Mutation 'R5983:Dppa2'
ID481533
Institutional Source Beutler Lab
Gene Symbol Dppa2
Ensembl Gene ENSMUSG00000072419
Gene Namedevelopmental pluripotency associated 2
Synonyms2410088E07Rik, ECAT15-2
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5983 (G1)
Quality Score184.009
Status Validated
Chromosome16
Chromosomal Location48303908-48319723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48315841 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 185 (M185I)
Ref Sequence ENSEMBL: ENSMUSP00000156143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097175] [ENSMUST00000232448]
Predicted Effect probably benign
Transcript: ENSMUST00000097175
AA Change: M185I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110183
Gene: ENSMUSG00000072419
AA Change: M185I

DomainStartEndE-ValueType
SAP 85 119 2.86e-1 SMART
Pfam:Dppa2_A 124 206 2.3e-34 PFAM
Pfam:DCR 211 277 4.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232448
AA Change: M185I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Dppa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Dppa2 APN 16 48311686 missense possibly damaging 0.93
IGL01365:Dppa2 APN 16 48313913 missense possibly damaging 0.83
IGL03279:Dppa2 APN 16 48311665 missense possibly damaging 0.91
IGL03331:Dppa2 APN 16 48313879 splice site probably benign
R0048:Dppa2 UTSW 16 48317398 missense probably benign 0.02
R0549:Dppa2 UTSW 16 48318671 missense probably benign 0.20
R1321:Dppa2 UTSW 16 48311636 missense possibly damaging 0.72
R1826:Dppa2 UTSW 16 48317348 missense probably damaging 0.98
R4553:Dppa2 UTSW 16 48310514 missense possibly damaging 0.59
R5124:Dppa2 UTSW 16 48311623 missense probably damaging 0.98
R5144:Dppa2 UTSW 16 48317303 missense probably damaging 0.98
R6638:Dppa2 UTSW 16 48314160 missense possibly damaging 0.86
R7060:Dppa2 UTSW 16 48315713 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATACATCTCGGGAGGCCAGA -3'
(R):5'- AGCAATCTGTTAAGTTCGATTCATT -3'

Sequencing Primer
(F):5'- CCAGAATGAAGCAGGGTCCC -3'
(R):5'- AAGTGGCACTGAACTACTGGCC -3'
Posted On2017-06-26