Incidental Mutation 'R5983:Rsph9'
ID481535
Institutional Source Beutler Lab
Gene Symbol Rsph9
Ensembl Gene ENSMUSG00000023966
Gene Nameradial spoke head 9 homolog (Chlamydomonas)
Synonyms
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5983 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46122035-46144216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46129480 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 230 (M230T)
Ref Sequence ENSEMBL: ENSMUSP00000024762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024762] [ENSMUST00000024763] [ENSMUST00000123646]
Predicted Effect probably benign
Transcript: ENSMUST00000024762
AA Change: M230T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024762
Gene: ENSMUSG00000023966
AA Change: M230T

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Radial_spoke 203 276 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024763
SMART Domains Protein: ENSMUSP00000024763
Gene: ENSMUSG00000023967

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 75 128 6.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123646
SMART Domains Protein: ENSMUSP00000122433
Gene: ENSMUSG00000023967

DomainStartEndE-ValueType
Pfam:Ribosomal_S18 75 128 4.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147672
Predicted Effect probably benign
Transcript: ENSMUST00000148581
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein thought to be a component of the radial spoke head in motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia 12. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Rsph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0547:Rsph9 UTSW 17 46144124 missense possibly damaging 0.86
R2040:Rsph9 UTSW 17 46134984 missense probably damaging 1.00
R5238:Rsph9 UTSW 17 46135082 nonsense probably null
R5602:Rsph9 UTSW 17 46134983 missense probably damaging 1.00
R7015:Rsph9 UTSW 17 46129456 missense probably benign 0.23
R7661:Rsph9 UTSW 17 46135087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAAGAGTGTTTCGACCCC -3'
(R):5'- CATCGATCTTAGGGCAGAGG -3'

Sequencing Primer
(F):5'- GAGTGTTTCGACCCCACATAAATATC -3'
(R):5'- CCAAGGTCAGTGATTTACCCTGAAG -3'
Posted On2017-06-26