Incidental Mutation 'R5983:Olfr1436'
ID481536
Institutional Source Beutler Lab
Gene Symbol Olfr1436
Ensembl Gene ENSMUSG00000067513
Gene Nameolfactory receptor 1436
SynonymsGA_x6K02T2RE5P-2634596-2633658, MOR214-2
MMRRC Submission 044164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5983 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12298183-12299130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12299103 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 10 (I10F)
Ref Sequence ENSEMBL: ENSMUSP00000085113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087812]
Predicted Effect probably benign
Transcript: ENSMUST00000087812
AA Change: I10F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: I10F

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-19 PFAM
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abhd18 T A 3: 40,910,544 F73L probably damaging Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Olfr1436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Olfr1436 APN 19 12298785 missense probably damaging 0.99
IGL02129:Olfr1436 APN 19 12298458 missense probably damaging 1.00
PIT4378001:Olfr1436 UTSW 19 12298712 missense probably damaging 1.00
R0727:Olfr1436 UTSW 19 12299094 missense probably benign 0.03
R1244:Olfr1436 UTSW 19 12298496 missense probably damaging 0.98
R1647:Olfr1436 UTSW 19 12298659 missense probably benign
R1648:Olfr1436 UTSW 19 12298659 missense probably benign
R1837:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R1899:Olfr1436 UTSW 19 12298343 missense probably damaging 1.00
R2031:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R2305:Olfr1436 UTSW 19 12299087 missense probably benign 0.01
R4624:Olfr1436 UTSW 19 12298983 missense probably benign
R4681:Olfr1436 UTSW 19 12299049 missense probably benign 0.05
R4790:Olfr1436 UTSW 19 12298941 missense possibly damaging 0.60
R4865:Olfr1436 UTSW 19 12298580 missense probably damaging 1.00
R4941:Olfr1436 UTSW 19 12298896 missense possibly damaging 0.95
R5138:Olfr1436 UTSW 19 12298776 missense possibly damaging 0.56
R5161:Olfr1436 UTSW 19 12298789 missense probably damaging 0.99
R5560:Olfr1436 UTSW 19 12298644 nonsense probably null
R6736:Olfr1436 UTSW 19 12298572 nonsense probably null
R6882:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R6883:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R7465:Olfr1436 UTSW 19 12298437 missense probably benign 0.04
R7500:Olfr1436 UTSW 19 12298677 missense probably damaging 0.98
R7529:Olfr1436 UTSW 19 12298722 missense probably damaging 1.00
R7565:Olfr1436 UTSW 19 12298848 missense probably benign 0.09
R7611:Olfr1436 UTSW 19 12298878 missense probably damaging 0.99
R7850:Olfr1436 UTSW 19 12298632 missense probably benign
R7933:Olfr1436 UTSW 19 12298632 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAAGCATCTTTGGGACTGTAGAAG -3'
(R):5'- AGGAAACACTGGGTTCCTCC -3'

Sequencing Primer
(F):5'- CTTTGGGACTGTAGAAGAGATATAGC -3'
(R):5'- ACACTGGGTTCCTCCTATGGAAAG -3'
Posted On2017-06-26