Incidental Mutation 'R5984:Olfr1079'
ID481545
Institutional Source Beutler Lab
Gene Symbol Olfr1079
Ensembl Gene ENSMUSG00000075179
Gene Nameolfactory receptor 1079
SynonymsMOR189-1, GA_x6K02T2Q125-48024195-48023254
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5984 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86536949-86542480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86538168 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 249 (V249E)
Ref Sequence ENSEMBL: ENSMUSP00000097467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099882] [ENSMUST00000111582] [ENSMUST00000216480]
Predicted Effect probably damaging
Transcript: ENSMUST00000099882
AA Change: V249E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097467
Gene: ENSMUSG00000075179
AA Change: V249E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 175 1.2e-7 PFAM
Pfam:7tm_1 43 292 7.1e-32 PFAM
Pfam:7tm_4 141 285 1.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111582
AA Change: V247E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107208
Gene: ENSMUSG00000075179
AA Change: V247E

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 1.6e-48 PFAM
Pfam:7TM_GPCR_Srsx 37 175 1.2e-7 PFAM
Pfam:7tm_1 43 292 2.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216480
AA Change: V247E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Olfr1079
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1079 APN 2 86538330 missense probably benign 0.12
IGL02289:Olfr1079 APN 2 86538448 missense probably benign 0.07
IGL02794:Olfr1079 APN 2 86538148 missense possibly damaging 0.80
R1498:Olfr1079 UTSW 2 86538558 missense probably benign 0.00
R1923:Olfr1079 UTSW 2 86538513 missense probably damaging 1.00
R2195:Olfr1079 UTSW 2 86538903 missense probably benign 0.05
R2211:Olfr1079 UTSW 2 86538513 missense probably damaging 1.00
R2925:Olfr1079 UTSW 2 86538547 missense probably damaging 1.00
R4370:Olfr1079 UTSW 2 86538420 missense possibly damaging 0.78
R4430:Olfr1079 UTSW 2 86538387 missense probably damaging 0.98
R4678:Olfr1079 UTSW 2 86538733 missense possibly damaging 0.95
R4790:Olfr1079 UTSW 2 86538880 missense possibly damaging 0.63
R4996:Olfr1079 UTSW 2 86538271 missense probably benign 0.02
R5905:Olfr1079 UTSW 2 86538769 missense possibly damaging 0.91
R6028:Olfr1079 UTSW 2 86538769 missense possibly damaging 0.91
R6878:Olfr1079 UTSW 2 86538765 missense probably damaging 1.00
R7579:Olfr1079 UTSW 2 86538528 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTGAGAGAAGAGGAGTTCTTTTC -3'
(R):5'- TCTCTGCTCTGCACAAATACAG -3'

Sequencing Primer
(F):5'- CCTGTGACTTCTATGAGAAAT -3'
(R):5'- TCTGCACAAATACAGATAAAATCGG -3'
Posted On2017-06-26