Incidental Mutation 'R5984:Gabpb1'
ID481547
Institutional Source Beutler Lab
Gene Symbol Gabpb1
Ensembl Gene ENSMUSG00000027361
Gene NameGA repeat binding protein, beta 1
SynonymsGABPB1-1, E4TF1-47, GABPB1-2, E4Tf1B, BABPB2, NRF2B2, E4TF1, E4TF1-53, NRF2B1
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5984 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location126627442-126676337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126646653 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 264 (T264A)
Ref Sequence ENSEMBL: ENSMUSP00000106054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039978] [ENSMUST00000089745] [ENSMUST00000103226] [ENSMUST00000103227] [ENSMUST00000110424] [ENSMUST00000110425]
Predicted Effect probably damaging
Transcript: ENSMUST00000039978
AA Change: T264A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037673
Gene: ENSMUSG00000027361
AA Change: T264A

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089745
SMART Domains Protein: ENSMUSP00000087177
Gene: ENSMUSG00000027361

DomainStartEndE-ValueType
Blast:ANK 5 34 4e-9 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103226
AA Change: T265A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099516
Gene: ENSMUSG00000027361
AA Change: T265A

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103227
AA Change: T264A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099517
Gene: ENSMUSG00000027361
AA Change: T264A

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110424
AA Change: T264A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106054
Gene: ENSMUSG00000027361
AA Change: T264A

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110425
AA Change: T265A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106055
Gene: ENSMUSG00000027361
AA Change: T265A

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
coiled coil region 329 382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Gabpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Gabpb1 APN 2 126653600 missense possibly damaging 0.83
IGL02085:Gabpb1 APN 2 126639271 nonsense probably null
IGL02190:Gabpb1 APN 2 126653549 unclassified probably benign
R0034:Gabpb1 UTSW 2 126658534 missense possibly damaging 0.94
R0114:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R0800:Gabpb1 UTSW 2 126630328 missense probably damaging 0.99
R0925:Gabpb1 UTSW 2 126652265 missense probably damaging 1.00
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1497:Gabpb1 UTSW 2 126639249 missense possibly damaging 0.96
R1569:Gabpb1 UTSW 2 126652251 missense probably benign 0.09
R2860:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R2861:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R5284:Gabpb1 UTSW 2 126652357 missense possibly damaging 0.93
R7200:Gabpb1 UTSW 2 126639302 missense possibly damaging 0.73
R7781:Gabpb1 UTSW 2 126639200 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CACAAGCATAATTCGGGCAC -3'
(R):5'- ACAGTCCTAAAACGATGGCTG -3'

Sequencing Primer
(F):5'- ACATGTGAGTGTCCTGAGCAC -3'
(R):5'- GTCCTAAAACGATGGCTGGAACTC -3'
Posted On2017-06-26