Incidental Mutation 'R5984:Hcn3'
ID481550
Institutional Source Beutler Lab
Gene Symbol Hcn3
Ensembl Gene ENSMUSG00000028051
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 3
SynonymsHac3
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R5984 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89146074-89160196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89148263 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 559 (E559G)
Ref Sequence ENSEMBL: ENSMUSP00000029686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029686] [ENSMUST00000047111] [ENSMUST00000107482]
Predicted Effect probably benign
Transcript: ENSMUST00000029686
AA Change: E559G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029686
Gene: ENSMUSG00000028051
AA Change: E559G

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
Pfam:Ion_trans_N 48 91 1.3e-22 PFAM
Pfam:Ion_trans 92 357 3.7e-25 PFAM
low complexity region 358 369 N/A INTRINSIC
Blast:cNMP 370 402 7e-14 BLAST
cNMP 427 540 2.32e-20 SMART
Blast:cNMP 548 588 2e-17 BLAST
low complexity region 636 656 N/A INTRINSIC
low complexity region 698 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047111
SMART Domains Protein: ENSMUSP00000035417
Gene: ENSMUSG00000041237

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PK 85 438 6.9e-165 PFAM
Pfam:PK_C 453 571 3.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107482
SMART Domains Protein: ENSMUSP00000103106
Gene: ENSMUSG00000041237

DomainStartEndE-ValueType
Pfam:PK 54 407 3.1e-163 PFAM
Pfam:PK_C 421 541 4.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133368
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that functions as a voltage gated cation channel. The encoded protein is a member of a family of closely related cyclic adenosine monophosphate-binding channel proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ventricular action potential waveform. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Hcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Hcn3 APN 3 89147723 missense probably damaging 0.98
IGL02285:Hcn3 APN 3 89152812 missense probably damaging 1.00
IGL02557:Hcn3 APN 3 89149871 missense probably damaging 1.00
R0027:Hcn3 UTSW 3 89159825 missense probably damaging 0.99
R0189:Hcn3 UTSW 3 89148800 missense probably damaging 0.98
R0442:Hcn3 UTSW 3 89151540 missense probably damaging 0.97
R0454:Hcn3 UTSW 3 89152894 missense probably damaging 0.98
R0732:Hcn3 UTSW 3 89148786 missense probably damaging 1.00
R1732:Hcn3 UTSW 3 89148119 missense probably damaging 0.97
R1900:Hcn3 UTSW 3 89148263 missense probably benign 0.00
R2277:Hcn3 UTSW 3 89147861 missense probably benign 0.02
R2279:Hcn3 UTSW 3 89147861 missense probably benign 0.02
R2331:Hcn3 UTSW 3 89148090 missense probably benign 0.01
R2916:Hcn3 UTSW 3 89147613 missense probably benign
R2918:Hcn3 UTSW 3 89147613 missense probably benign
R4604:Hcn3 UTSW 3 89150440 missense probably damaging 1.00
R4749:Hcn3 UTSW 3 89150063 splice site probably null
R5095:Hcn3 UTSW 3 89149923 missense probably damaging 0.99
R5776:Hcn3 UTSW 3 89148105 missense probably benign 0.03
R6389:Hcn3 UTSW 3 89150933 missense possibly damaging 0.70
R6736:Hcn3 UTSW 3 89152674 missense probably damaging 1.00
R6860:Hcn3 UTSW 3 89159845 missense possibly damaging 0.73
R6909:Hcn3 UTSW 3 89152629 critical splice donor site probably null
R7549:Hcn3 UTSW 3 89150000 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- TGGTGAGTCAAGGCTATGGC -3'
(R):5'- CTAGCGAGAAATTGCCGTGGAG -3'

Sequencing Primer
(F):5'- TATGGCCACGTTGGAGGTCAC -3'
(R):5'- AGAAATTGCCGTGGAGTGTCTC -3'
Posted On2017-06-26