Mutagenetix > Incidental Mutations

Incidental Mutation 'R5984:Ptgfrn'

481551

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

043251-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5984 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101050143 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 705 (D705G)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably damaging
Transcript: ENSMUST00000102694
AA Change: D705G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: D705G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9830107B12Rik	T	A	17: 48,128,555	L130F	probably benign	Het
Alox12	T	C	11: 70,247,055	T420A	possibly damaging	Het
Ano5	T	C	7: 51,593,664	I795T	probably damaging	Het
Crlf2	G	A	5: 109,555,603	P92L	probably damaging	Het
Dgat1	T	C	15: 76,502,258	Y492C	probably damaging	Het
Dna2	G	C	10: 62,962,506		probably null	Het
Dst	A	G	1: 34,172,263	H982R	probably benign	Het
F13b	A	G	1: 139,508,212	D252G	probably damaging	Het
Fam173b	C	T	15: 31,616,919	R99*	probably null	Het
Fgfr3	A	T	5: 33,729,705	E151V	probably damaging	Het
Gabpb1	T	C	2: 126,646,653	T264A	probably damaging	Het
Gemin5	T	C	11: 58,156,761	E329G	probably damaging	Het
Git1	C	T	11: 77,506,483	P721S	possibly damaging	Het
Hcn3	T	C	3: 89,148,263	E559G	probably benign	Het
Invs	G	A	4: 48,421,674	A769T	probably benign	Het
Ism2	T	A	12: 87,287,035	T79S	possibly damaging	Het
Lamb1	G	A	12: 31,327,774	E1673K	possibly damaging	Het
Lmtk2	T	A	5: 144,174,838	L792H	probably benign	Het
Lnpk	A	T	2: 74,522,199	S380T	probably benign	Het
Mff	A	G	1: 82,731,127	I66V	probably benign	Het
Mtor	A	G	4: 148,538,827	K2045E	probably benign	Het
Mycbp2	C	A	14: 103,126,684	W4393L	probably damaging	Het
Olfr1079	A	T	2: 86,538,168	V249E	probably damaging	Het
Olfr391-ps	T	A	11: 73,799,581	M59L	possibly damaging	Het
Pcdha5	A	G	18: 36,961,680	D414G	probably damaging	Het
Pknox2	T	C	9: 36,923,726	E149G	probably damaging	Het
Plxdc2	A	G	2: 16,660,855	R240G	probably benign	Het
Polr3d	A	T	14: 70,439,487	F389Y	possibly damaging	Het
Prex1	T	G	2: 166,585,744	D826A	probably damaging	Het
Prss50	T	A	9: 110,862,386	S253T	probably damaging	Het
Ptpn21	T	A	12: 98,689,076	N544I	probably damaging	Het
Rbm5	G	A	9: 107,744,942	P611L	probably damaging	Het
Rev3l	A	T	10: 39,742,689		probably benign	Het
Rnf139	T	C	15: 58,898,746	Y207H	probably benign	Het
Scn11a	C	T	9: 119,784,016	R836H	probably benign	Het
Slc30a1	A	G	1: 191,907,100	T32A	probably damaging	Het
Smad4	T	A	18: 73,677,911	M1L	probably benign	Het
Sos1	T	C	17: 80,452,132	D190G	possibly damaging	Het
Sptbn1	C	T	11: 30,118,464	D1677N	probably damaging	Het
Tmem132e	G	A	11: 82,445,097	D1002N	probably damaging	Het
Usp8	C	A	2: 126,742,481	Q526K	probably benign	Het
Wt1	A	G	2: 105,172,252	S488G	probably benign	Het
Zbtb43	A	G	2: 33,454,260	S318P	probably benign	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGCCAGCAATGAGTCAGG -3'
(R):5'- TTTGTAGACCGATTCCCAGAAAAG -3'

Sequencing Primer
(F):5'- CCTGTTTATAGAACCCAGGATGGC -3'
(R):5'- AGAGAGCCACATTTAGATGCTCTTGG -3'

Posted On

2017-06-26