Incidental Mutation 'R5984:Ptgfrn'
ID 481551
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms CD9P-1, 4833445A08Rik
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5984 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 101040232-101110278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101050143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 705 (D705G)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect probably damaging
Transcript: ENSMUST00000102694
AA Change: D705G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: D705G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5600:Ptgfrn UTSW 3 101056250 missense probably damaging 0.99
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5927:Ptgfrn UTSW 3 101060652 missense possibly damaging 0.92
R6124:Ptgfrn UTSW 3 101073089 missense probably damaging 0.98
R6331:Ptgfrn UTSW 3 101045620 missense possibly damaging 0.64
R6363:Ptgfrn UTSW 3 101045578 missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 101043409 missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 101056437 missense probably benign 0.19
R8093:Ptgfrn UTSW 3 101072941 missense probably benign 0.09
R8490:Ptgfrn UTSW 3 101056370 missense probably damaging 0.99
R8856:Ptgfrn UTSW 3 101056611 missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCCAGCAATGAGTCAGG -3'
(R):5'- TTTGTAGACCGATTCCCAGAAAAG -3'

Sequencing Primer
(F):5'- CCTGTTTATAGAACCCAGGATGGC -3'
(R):5'- AGAGAGCCACATTTAGATGCTCTTGG -3'
Posted On 2017-06-26